Open Close
General Information
Symbol
Dmel\emb-RB
Species
D. melanogaster
Annotation Symbol
CG13387-RB
FlyBase ID
FBtr0346708
Feature type
Associated gene
Evidence Rank
Length (nt)
3919
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 110 )
Sequence
ATACGGGCACACTGTTCTCACAAATTGCATTTCGCATTGTCCGTCGTCGTCGTTTTCACACGCTGCTCTTTTCTGGAATC
GGTAAAAGCTTCAGGTCCAGTCCCGGCACCAGATCCAGATCCCGATCCAGATCGAGAGTCGCCGCTCCTCACCGTCATCA
TAGTGCGAAGAAGAAGAAGCTGAAGCAGAAGCCGCCGCGCACTTTCGATAAATAAAGTGGAAAAAAAAAACAGCAAAAAC
AAGAAATCCAAAGGGAAAAAACGTGAGATCCGAGCTCATCCGGCGGAGGAGGAAGCCAAGAAGCTATCAAAATTAACGCG
GACACAACTGCAGAGCGACGCCGACGCGAACGCCGCTTCTACTACAAAGCGATGGCGACAATGTTGACATCGGACGAGGC
GGGCAAGCTGCTCGACTTCTCCCAGAAGCTGGACATTAATCTGCTGGACAAGATCGTCGAGGTTGTGTACACAGCGCAGG
GCGAGCAGTTGCGTCTAGCCCAGAGCATACTGACCACGCTGAAGGAGCATCCAGAGGCATGGACGCGGGTGGACAGCATA
TTGGAGTACTCACAGAACCAGCGGACCAAGTTTTATGCTCTGCAAATCCTCGAGGAGGTCATCAAAACGCGCTGGAAGGT
CCTGCCGCGCAACCAGTGCGAGGGAATCAAGAAGTATGTGGTCAGTCTTATCATCAAGACCTCGTCGGATCCCATTGTTA
TGGAGCAGAACAAAGTGTATCTGAATAAGCTAAACATGATTCTGGTCCACATTCTAAAGCGCGAATGGCCACGCAACTGG
GAGACATTCATCAGTGACATTGTCGGTGCGTCGAAAACGAACGAGAGCCTGTGCATGAACAACATGGTAATCCTGAAGAA
CCTTAGTGAGGAGGTGTTCGACTTTTCGCAGGGTCAGATCACGCAGACTAAGGCCAAGCACCTGAAAGACACCATGTGCT
CGGAGTTCTCTCAGATCTTTACACTATGCTCCTTCGTGCTGGAGAACTCGATGAATGCCGCCCTAATCCATGTCACGCTG
GAGACTCTGCTGAGGTTCCTTAACTGGATACCGCTGGGCTACATCTTTGAAACGCAGCAAATTGAAACGCTGATATTCAA
ATTCCTTAGCGTACCCATGTTCCGCAATGTGACCCTGAAGTGTCTGTCCGAGATCGCCGGCCTGACTGCGGCAAACTACG
ACGAGAATTTCGCGACGCTCTTCAAGGACACGATGGTTCAGTTGGAACAGATAGTCGGCCAGAATATGAACATGAACCAT
GTGTTTAAGCATGGTTCCGACACAGAGCAGGAGCTGGTCCTTAATTTGGCCATGTTCCTGTGCACCTTCCTCAAGGAGCA
CGGCAAACTGGTGGAGGATGCCAAGTATGTGGACTACCTGAATCAGGCGCTCATGTATTTGGTGATGATTAGCGAGGTGG
AGGACGTGGAAGTATTCAAGATCTGTCTGGAATACTGGAACAGCCTTGTGGAGGATCTATACAATTCGGAATTCTTCCAC
CCCACCCTGGAGTCTACAAAGAGGCAACAAGTGTATCCCCGTCGACGTTTCTACGCCCCCATCCTGTCCAAAGTGCGATT
CATTATGATCTCGCGCATGGCCAAGCCGGAGGAGGTGCTGGTGGTGGAGAACGAAAACGGGGAAGTGGTGCGCGAGTTCA
TGAAGGACACAAACTCAATAAACCTGTACAAGAACATGCGCGAAACGCTGGTCTTTCTTACCCATTTGGACTCTGTGGAC
ACGGACCGCATCATGACGCTAAAGCTGCTTAATCAGGTGAACGGATCGGAATTCTCTTGGAAGAACCTGAACACGTTGTG
CTGGGCCATTGGTTCCATATCCGGTGCTTTTTGTGAAGAGGACGAAAAACGGTTCCTGGTCACCGTGATCAAGGATCTAT
TAGGCCTGTGCGAACAGAAGAAGGGCAAGGACAACAAGGCCATTATTGCCTCCAATATCATGTATGTGGTGGGACAGTAT
CCACGCTTCCTGCGCGCCCATTGGAAGTTCCTCAAGACGGTGGTAAACAAACTCTTCGAATTTATGCACGAAACGCACGA
TGGTGTCCAGGATATGGCATGCGATACGTTCATCAAGATAGCCATCAAATGCCGCCGCTACTTTGTCACCATCCAGCCGA
ATGAGGCATGCACCTTTATTGACGAGATTCTCACAACAATGAGCAGCATCATTTGTGATCTGCAGCCGCAGCAGGTTCAC
ACGTTCTATGAAGCTGTCGGCTACATGATCTCCGCCCAGGTGGATCAGGTACAACAGGACGTCCTCATCGAGAGGTACAT
GCAACTGCCCAACCAGGTGTGGGATGACATCATCTCCCGCGCCTCGAAAAACGTTGACTTCTTGAAGAACATGACCGCTG
TCAAGCAGCTGGGCAGCATCCTTAAAACGAATGTGGCTGCCTGCAAAGCCCTGGGTCACGCGTATGTCATTCAACTGGGC
CGCATATATCTGGACATGCTGAATGTGTACAAGATAACATCAGAGAATATCATTCAGGCCATCGAGGTGAATGGCGTCAA
TGTGAACAATCAGCCCCTGATCAAAACCATGCATGTGGTCAAGAAGGAGACGCTTAACTTGATATCCGAGTGGGTGTCTC
GTTCCAACGACAATCAGTTGGTGATGGACAATTTCATACCGCCTTTGCTGGACGCTATACTGCTAGATTATCAGCGCTGC
AAAGTTCCATCGGCACGGGAGCCCAAGGTTTTAAGTGCGATGGCAATCATTGTGCATAAACTGCGTCAGCATATCACAAA
TGAAGTACCAAAAATATTTGACGCCGTCTTCGAGTGCACGCTGGACATGATCAACAAGAACTTTGAAGATTTCCCACAGC
ACAGACTTAGTTTCTACGAGCTACTGCAGGCGGTCAATGCGCACTGCTTTAAGGCGTTCCTTAATATACCGCCGGCTCAG
TTCAAACTGGTCTTCGACTCGGTGGTGTGGGCATTCAAGCATACCATGCGGAATGTGGCCGACATGGGATTGAATATCCT
ATTTAAGATGCTTCAAAACTTAGATCAGCATCCCGGTGCGGCGCAGAGCTTCTATCAGACGTACTTTACAGATATTCTAA
TGCAGATATTTTCGGTGGTCACTGACACCTCACACACGGCCGGGTTGCCCAATCATGCCATCATTCTGGCGTACATGTTC
TCACTGGTGGAGAACAGGAAGATTACGGTGAACCTGGGTCCGATTCCGGATAATATGATATTCATACAGGAATATGTCGC
GTCGCTGCTGAAATCGGCATTTACCCATCTGTCCGATAATCAGGTCAAAGTCTTTGTCACTGGCTTATTCAATTTAGACG
AGAATGTGCAAGCATTTAAGGAGCATTTGAGAGATTTTCTCATACAGATTCGCGAGGCCACCGGCGAGGACGATTCCGAT
CTGTACTTGGAAGAGCGTGAAGCGGCTCTGGCCGAGGAGCAGTCAAATAAACATCAGATGCAGCGTAATATTCCAGGAAT
GTTGAATCCGCACGAGTTGCCCGAGGATATGCAGGACGAATAGATGTCGATGTCGATGTCGATGTCACTGAGCTAGAATG
TTTTAGTTGATGCTTGAGAATGATAAAAGGATGGTGATGTATGAGTGTTTCTCGAGCGAGAAAGTATAAATGTTTGTTTG
ATTGAATGCATATAAGTACGTTATATATATAAATACATCCACACAAGACCCACAACACTTGCATACACACACATACACAT
ACACCTATACAGATATAGCTGCGTTAAAAGGTGAATGAGTAAATGGTTATTCGTGCGCAATTACATACATTAATATGATT
AACATATTTTTGCGCATTGTCCTCGACATACCAGCATAAATAAGATGCCCAGCCAGTTCCCAACTCCCGCTCCCCTATC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0079663
4492
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0312321
1063
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0079278
1063
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
emb-RB
Secondary FlyBase IDs
    References (0)