Open Close
General Information
Symbol
Dmel\Wnk-RM
Species
D. melanogaster
Annotation Symbol
CG7177-RM
FlyBase ID
FBtr0346818
Feature type
Associated gene
Evidence Rank
Length (nt)
8089
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 19 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      GTAAAATTTTTTGTGAAAGTAAAGGGAACTTCTGGCGAAATAACTTCAATTTTCCGCTGACTCTCGCACGCGTTCAATCC
      AATTGACCCCCCTTGTGGAGGTGACACTATCTCCCGAAAGACTTACCAATCCCCCGTGCCGTAATATGAAAGCTTGCTAG
      CTCGAATTGCCTTTGAACACCACAATCACAAATTGAAATCCTCGATGCGAACGATCCGACAGTCGCAGTGCGAGCCCTAG
      ACCCCGTCCCGGTCGTAAATCCCCAACTCGAGCACGATCCCGTCGAGCGAAGGACTTCCGGAAGGAGCGGCGTGGAAACA
      TGACATCATAGTCGCTGCATATGCTTCCTGTCCCGAATCAAATGTACATAAATATATTAAACGTGGTGGTCTGCTGCTAA
      AAATCTTGCAAAATTGGACAAACCCTCTGCGACTTCGTACGACAACAAGAGGTCGTACCTGCGAACCGTGCTCGGAAGGG
      AAGCGCCATCAGCGAAGATGGTACTACCTCCTGCACCACGCAACCTCAAAGGAATACCTCAATTTCTAGCGAGGAGCAAA
      CTGTGCAGGGAGCTAATATACAAAAGTCGGGACACCGTTCGTTTAATAGATCTGCCTCCTCTAGGCAAAAGCCGAACCCG
      ACATCAAAACTAAAAGACACACTAAACAGAAAGCCCACTTGCAAGCAGGGCACACTTTCTGCACACACGAGCACTAGCAG
      CACCACTTCAATCCAGTCATCACCTATCGAGCCAGCTTCTTCTCTACCCACGCTGAACACCACGCCTACACCACCAGCTG
      CCAGCAAAAGTAACCTATTTGTGCGGGTGCTAAGACGCTTTTCAAATAACACCCTTCCCGGCAAAACGGCGTCAAGCCCG
      AAAAACGTGGACGACGTACCGAAAGTCAACGATAACAACAACGGCGATTTAGGCAAACAGCAATCAACCGATGTAGAGGT
      GCTTTGCTCTCAGGACAACCAGAGCAGGGAACAGAATGAGGACGAAATGGATAGCAAAATAGAACCTGCAGATGCCATAA
      GCAACCAGAAAGCTGGTCTTACTTCGGGCAAACCTAAAAAAGACAAGTCAGTCAAGGGGACGTCGCAAGCGGTTGTTTCA
      GACACCAAGAAAATGGAGGCCAGAAAGTCCTCCTCGGACACGGTGATCGAGCCATTGATCAAGCAGCAGGCGCCACTGCA
      CTCGTCAAAGACCACGCCAACGACTTTGACGGCGAACTTCGTGCAAAACATTCGATTCGTCCGTAAAAATGTGGAACAGT
      CAGGCAGGAACACCAATCCACTGCAGTTCGTTGAACTCGAGACAGAGTTTCCTCGTGACTATGACGACAACATCGAGATG
      CTTTCCCGCGAGGCGGAGCATCTGGAGGAGCAGTTCCGCACGCCTACGCGCTCCAATGCTACGGATGCCACTTCCCACCA
      TGTGGCCGGAATCATCGACAACATTATAACCGAAGCGTCACGGAGTCTTACAATCGAAAAGACTGAAGACGATGTGCCAT
      TGAAGTCTTCTACCAAGCACTCAAGCGGCGTAAAACGAGTTGGCTTTCAAGTAGAGGATAAGGACGATACCGAAGTTCAG
      AGCGAAAAGCAGGCAAAGAGCTTCGACGACATAACCAAAAAAGCGGAGAGCTCCGAGGCTAGCGCAGAGGAAGCTGCTGT
      CACCGGGTCCTCGACAGATGCATCTGCATCTCCCCTGCCCTCCACGTCGCTGGTCTCCACCACATCTTCAGCTACATCGA
      TAACCAAGAGTAAGAGCGATGAGGACGATGATCCGGTGGCCATGTCGCCGTGCGGACGATTCTTTAAGTACGATAAGGAA
      GTCGGACGCGGTTCCTTTAAAACTGTCTATCGTGGCCTGGACACGTTGACTGGTGTTCCAGTTGCCTGGTGCGAGTTATT
      GGACAAGCAAGTAAAAAAAAGTGAACGTACTAGATTTCGCGAGGAGGCAGACATGCTGAAGAAACTTCAGCACCCAAACA
      TAGTGCGGTTTTATACATATTGGGAGTTTCCTATTGGCCGCAAGAAGAATATTGTACTAGTCACCGAACTAATGTTATCT
      GGAACTTTGAAATCCTATTTGAAACGATTCAAAAAAATACACCCAAAGGTATTGAAGTCATGGTGTCGCCAGATACTAAA
      AGGCCTTAACTTCCTGCATACTCGTCAATTTCCTATAATTCATCGTGATTTGAAATGTGATAATATTTTTATAACTGGCA
      CCACTGGTAGTGTTAAAATCGGCGACTTGGGCCTGGCAACTTTGAAAAACCGCTCCCACGCGAAATCTGTGATTGGTACG
      CCGGAGTTTATGGCCCCGGAAATGTACGAGGAGCACTACGACGAGTCGGTGGACGTATATGCATTCGGCATGTGCATGTT
      GGAGATGGCCATTTCCGAATATCCTTACAGTGAGTGCAAGGGTCCTGCACAGATCTACAAAAAGGTGATATCGGGCATTA
      AGCCAGCGGCGTTGGCTAAGGTGGAGGATCCCAACGTGCGCGACATTATCGAACGGTGCATTGAACTTAAAAAGGAGGAT
      CGCCCCAGCTGCAATGAACTGCTAGAATCGGAGTTCTTTGACGAAGATATCGGTATACGAGTGGAGCCAACTGCTTCGGA
      GCAGTTCCTTTCTGATCCGAGCATCAGCATCATCGAGTTCCGACTGCGGTTTATGGATCCCAAGAAGCGCTCGTCCCGTC
      ATAAGGAAAACGAGGCAATTCAGTTTGAGTACAACATCAGGCATGACGAGTACGAACAGATTGCGCAAGAAATGATGAAG
      GAAAATATTATATCTGAGGACGACTCTCGCGCTGTAGCTCGGCTTTTAAAAGTGCAGGTGGTGTCGTTGCTTAAGGAACG
      TGCCCAGCGTCAAACTCAAATCAAGCTGCAAAACGAGAAGTCTCGTTTGGAAAAATTGGCATTGCAAAAGCAACGTGAGA
      GTTTGCCGACTAACGTCGATGAAGACGAGGAAGAGGAGGAGGAGTCCGAGGACGAGGAGGATGGTGTTAAATGGAATCAG
      CGCCTGCAGCTAAGATATGACCTGCTTAACACTGATTCAGAAACAAGCCTGGCTCTATCCACGAACAGCGTCGAACCGCA
      GCAGCTGTCCACTCGCTCGAACACTTCGATTCCGAACAGTGGCATTCAGCAACCTGTTCAGGTCCCAGGTCAAGTGCCTG
      TTTCCCAGTTGATCTCGGTGCAACCACAGGCTATTCCGTCACCGGCTATTCCCATGCAACAGAAGCCGACGGTGCACTAC
      ATTCAACCGCCACAGCTGGCCTCTTATCAAAATTCGAATGCATCGATGCAGGAGATGACCAATAACCAGGTCATTTCGCC
      GACAGGCAGTCAACAAATGCAACAGCAACAACCCGTAGTGGCACCAACAGTCAATCATCAGGTCATGCCGCAGCAGCAAG
      TGAACCAACAACAGCAACAACCACAAATGATGCAGCAAATACCCCAGCAAGTTCAAGTGCAACAGCCCCAAACTGTATTG
      CCTCCGCAGCCACATGAGCAGCAGCCACAGCAACAACAACAGCCACTGCAGCAACAACTGCAGCAGCTTATGCATACTAA
      CGTGCAGGCTCCGGATTTGACTCAACAGCAACAAATGGCTCAGCAACAGGCCCAGCAATATTTTCAGCAGCAGCAGCAAC
      AGCCTCAGCAGGCCGTTAACATGCAACAAGCTTATGCAATGCAGCAAGCTGGCCAACAGCAACAGCTTTCGCAGCCTCTT
      CAAATTCAGCAACAGATCTTGCAGCAACAACAAGTGGCCGTTTCACATCAGCAACAGATAATGCAGCAACAACTGGCCCA
      GCATCAGCTGCAACAGCTGCAGCAGCAGCAGCTTCAACAACAGCAACTGCAACAGCAGCAGCAAATACAACAACAGCAAC
      TCCAACAACAACAACTCCAGCAACAGCAATTCGTACAGCAGTATGCGCAGGCAATGCCTCAGCAACAACATCAGCAACTC
      GTTACGGGATCGCAAGTCATGGCACCGCATCAACATCAGCAACCTATTCAGATCCCAGTGCAGATGCAAGTTCCACCGAC
      GTCCGTGGCTCCTCCAATACAACACACTTACAATCAGCAGGGCGGACAAGTAACGCTCAGTGATGCCCAACAGCAACAGC
      ATCCTGGATTCTCGGCCGTACCACAACAGGCAGCGCCATTTATACAACAGCCCACACAGCAACCCATTCAGCTATCAATG
      CCTTTGGAACAACAATTGCAGCAATTGCTGCATAGCCAGCCAGCCCAGCAACAACAGGCCATGAGCCAACAGCAGCAACA
      GCCCTTGGTGCAACAGCAACAACTGCCTTTGGTACAACAGCAGCCGCCTTTGGTCCAGCAGCAGCAACCGCTGGTTCAGC
      ATCAGCAGCCTTCGGTCCAACATCAGCAACCTTTGGTGCAACAGCCCCAGCAACAGCAACCACAGCCCCAGAATCAGCAA
      CCACAGCCCCAGACACAGCAAACACACGTGGTTCAGCAACAACCACCACAGCAGCAACCTGCAGTAGAGCAAATCTCACA
      GATTTCTTCGCAAGTGCCTGTTCAACAGGAAAATCTGCAGCCAATACAGGTCAACAAAGATGCGAATGTCGCAACGGATG
      CAATGTCCCTAAATAGCGCCCACGGTGCCCTCGAACCTGCACCGAAGACCGAACCCCAGAACTCTGCTGATGCGGAAAAG
      CAGCAAAAGCAGACAGGCACGGGCACACGTTCCCAGAAACCGAGGCGATCAAACCGGAGCGGCAACGAACGGATTCCCAA
      ACTTAGTGTAACCAGCGTCGACGAGGGCAGCGTCATAAACTGTCACATGGAAAATAAACTTAAAACGATTACATTTAAAT
      TCGACATAGGAGACGTAAATCCGGTTGAAATAGCCAATAAATTGATCGCCCAAGATTTGCTTTCTAATTGTCAAAGTACA
      GTTTTTGTGGAAATGATCAATGAAATTGTTGACCAAGTCAAACAGAATCCCAATCAAATCCCTATACCGACAAATTATCG
      CCGCAATATTGAAAAGGTCCGACACGCGTCTCTAACTCGACAGCGTTCCACGTTTAGGTCACACCAAAGACATAGATCTC
      GGGATGAAACCGCCAGCGACATCACAAAGATGTTCGAGCCCACTATCCATGGTGTTGAAACCCTGCCATCCGGTGGAGGA
      GGCGCTGAACAGTCAAACTGCAACTTGACTTTAGAGGCCAGGTCCCATTTATCCAACATACCAAATGCGAAAGAACCACA
      GCTGAACGTCAGCACTCCGCCCACAACCACTTCGACTATGTCTTCCTCATCAACCGCATCGAGGGATGCGCCCAATAGTA
      GCAATGACGTGACCATCGGCTCTGGTTCCGTTTCTCGAAAAACGAGCACGGCCTCGGAGTACACTTCGCTATCGATTGAC
      TATATGCCCGACAGCAACATTACTCCAACTGGTCCGGAGCCACCGCTTGACGATGGCAAGGATAAAAAACCTTGCTCCCT
      TGCTATAGCCAGAATGCAAAAGCTCTTGGAGTCGGCCGGCAATGGTGCTCCTCGCAGCCTGAATTTGCCCTTGAATCGTC
      ACCTGAAAATTCAAGAGGACTTGAAGCATACTAGAAGTCTTGACGATTTGACCGCAGTGAAAATAACCTTTGACATGCCC
      AACAAGGCTGCATTGGACACTTCGGAAAACGCTCAGCAGGCCACAGAAGCGGAAGCGGAGAAACCAAAAGATAAATCCGG
      ACAGGCAGTAGGCAACCAGGGAACTGGAGCGGCCAACACTCTAGAGCAGTTAAAAATAGAACTGGAGAACATTACTCATG
      CCCACGCGTTTGCCTCCGCTGTAGTGGCCTCGATTAACAACAGAGCTCCTCATCAAGCTTCCCCAGCAATGTCCTCCCTA
      AAGGCCACTTCTGGACAACCACAGACACAAGAGATAACCAAGCCAAATAACGGAGCAGGCCCTTCAGTACCCTCAGTGGG
      TCAGAATACTCCCACTGCAGCCTTAACATCCGCCAGGGGCTCAGGCTCCTCCGTCTACAACTCACGTCGCACATCCATCG
      ACAACAGCGTGGGATCCGACATGCACCTGCACACTGCCACTAATCTTGAAGGGACAGTGAGCAACCCGGATCCGATCCCG
      ACTGAGGCATCGGTTGGAATTACCATTGCTACGGGTCATGAGAAGCAACTCTCCAAGCAGCCCAGTTTGGAAAAGCCTTC
      TGCCACTTCCATTTTAACGAACAACAGTGATCCTCCGCAAAGGAATCCCAGCAATGGATCAATTAACCAAAATTCAATAG
      CTGATTTGGAAAAGAAATTGGCAGCTTTGCGAAATACCGAAAACACAGAAGAGTCTGCAACAGCAACGTTGTCAGTGGTT
      CCTAAACAAGTTGAAGAGGTAGTCAATCCAAGCGCGCGTAAAATTTCGCGTTTTAGTGTCAGTCGTGTGCAGGAGCAGAA
      AACTTCAACCGGAGTTGAGGAACCAGCTCAAGGTCAACTTAAGATCGACCTCCAAGTCGCCGGCCCTGGAGGCCAGGTGC
      AGACCAACAACTCCGTTCAGAACGGCAGCGTGGTCAACACTCCAACCGAAGTCATCAGCTCTCCTATTCAAAATGTTCCG
      CTGGCCATTAACGGAATTCAGTTGATGTACCAACAGCCCCAGCAGATACACCAGTTGCCAGGTGGAACATCAACTACTAC
      AAGTGGAGCAGGGACTCAGTGCATTGTAGTGCCGCAAGTGGTCAATCAAAATGGCACCCACGTGCAACAGCCGTCTAACC
      TACAGCCACAGCAGCAGAGCGTACATCCAAATATGACTCAACAGCCACAGCAGACGCCACTTAATGGGCACCCATCTATG
      GTTAACACTCTTCAGCAGCAGCCACCACAACAATCCTTACCGATGCAGACGATTCAGTCGCAGCAGCAGCAGCATAACCA
      AATGCCTATCATTTCGCAACAACAGCAGCAGCAGATCCTAATGCAGCAGCAACAGCAACAGGGATCCCAGCAAGGATCAC
      AGCAATTTAATTTGCCTGGCACACAACAGACTCATCCTCAGCACCAGTTCATCCAGTCGCAGCCCAACCAACTTCACTCG
      CTTCCGCCCCAGGTAGTGAGCATGGCTCAGGGAAATCTGCCGCATCAGCTTCCACCCATGCAGACTATGGGAGCCCAACA
      GCAAATGATCTCGCAACAACAGCATCAGTTGCAGATGCAGTCGCATATGCACCAACAAAACGTGCCCGGAATGTACAACC
      AGCAGACTGGAGCTCGTGTGGCAGCACCCCAAAATTTCGCAGGTGCAGTTCCAAATCATTTGTTGCAGCAGTCCCCTTTG
      ATGGCATCCCAGCAGCCAGCACAGCCCATGCAACACGTTATGCAACCGATTTTCAATGCAACGTCCGGTGAAGTTACCGA
      AGAGCCTGTCTCTTTAGCAGCTACGCATCCGCATCTGCTACCGAGCGATATTCAATCCGATATAAAGCACAATTTAGACT
      CATTAGTGAACCAATTGTGCAATACGCGCTTGGGTACTAACCAGCACCAACGGCTGTTGCTGTTGCGTCAGAGACAACTC
      ATCGAAGAGGACGAGCTGCGTCTTAAACATTATGTGGAATACGAAAAGTTCCAAAAGGCACTGCGCCAATCTATTAGCAC
      AAACGTTCCAGCTAATGCAGCTTACTATTCTGCGGCTGCCGCACAGCTTCCAACTAATTTGGCAGCCCCAGCAGCTCCGT
      CCTCATCGAATCCGACGTCCACTAGCTCCGCAAACACATAACTGCTCTAAATGTTTAGCTTCATGCACTTTTGGCAAGTC
      ATACTAACAGCTCTACTCTATGTTCTCGGCAATATAATTGGCACGAGCGAAAGGACGTGGATCTGGAGATAGATTTTAAG
      TAAAAAGTTGTCAAATGTTACGGGGTTGTCTGTAAATATTAGTCAAACGCTTCTTGTTGATATGCCATTGTTTTAAATTT
      CTCTTTCTGTTTCACTTTTTATTTAAAATGCCTAATTTCCCATTCTGGCTTTCGTTTATTTGTTTAAAATAAATATTAAA
      TTTTGTATG
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0346817
      7916
      FBtr0346819
      8199
      FBtr0347540
      7916
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0312393
      2462
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0312392
      2441
      FBpp0312394
      2441
      FBpp0312580
      2243
      Comments

      Unconventional translation start postulated (AUU encoding Met).

      Extended 3' UTR based on RNA-Seq and/or EST data.

      translation_exception: non_canonical_start_codon

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      Wnk-RM
      Secondary FlyBase IDs
        References (0)