Open Close
General Information
Symbol
Dmel\psq-RN
Species
D. melanogaster
Annotation Symbol
CG2368-RN
FlyBase ID
FBtr0346958
Feature type
Associated gene
Evidence Rank
Length (nt)
6336
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 81 )
Sequence
AATGGCGAACACGAGCACTCCGATGAACGACGAGCTGAAAAAATAATTATTATTTTAAATTCCGTTTTGCCAGCGAAATT
CGGTGCGTGCGCGAAAAAGAGTGCGGAAAAGCGCGGTTGAGAAATTTAATCGGCCCATTATGAAGCGGTCAAAGTGCGGC
GCCAATGCAAATGGTTAGCCAAATGGCAAGAAATATGTAGCGATAGCGTGCCAGCCCAGTAAAATCAAATAGAATCAAAT
TTAAGTTTCTTGCTTTGCGAATTATGAAAAACCAATCGCAATGCGTGTGTGTGTGTGTACGTGTGGTGCGTGCGCGCGTG
TGTTAGTGAGCGAGCGTAGAAGCAGAAGGCGTAGCGAGAAATAAAAATAAAAAACCATACAATAATTGATTTAAAAAAAA
GAAAAGCAAAAAGGCCAACAAACGAAAAACAGCAGAAGCAACAAAAACACACGACAAGCGGCAGCAAAAACAACAACACA
AAACTGGCGGTAAATACGCATACAGTACGATACAAAAAAATAAACTAGAAGCAACAACAAATACGCAACGTAACGGGAAC
TCTTTGACGTATTTCCTCTATTATTATGCAAAAAGGCAGGCGGCAAATTGCAGCAGCAGCGAAAATCAAATATAAATAGC
GAAAAGTATACTGGAGTATACACACATTTCCGCAGCGTGTTGAGCACGCCACAAGCATAAACAAAAGTGAGCAACAGGAA
TTCAGCTAGGATTCGGCGTGAAACGAATACGAAAAACCATACGAAATGGCAGCGGTTCGAGGACATCAGTATTTCAGTCT
GCGCTGGAATAACTACCAGAACACGATGACGTCCGTGTTTCAGCAGCTGCGCGAGGATCTCTCCTTTGTGGACGTCACTC
TGTCCTGCGAGCATGGATCCCTCAAGGCGCACAAGGTCGTCCTGTCCGCCTGTTCGACGTATTTCCAAAAACTACTGCTC
GAGAATCCGTGCAAACATCCCACAATTATCCTTCCCGCCGACATTATCTTCACCGACCTGAAAACGATCATCGATTTTGT
TTATCGTGGTGAAATCGACGTCACCGAATCGGAATTACAGGGCCTCTTGCGCACCGCCGAGCAGCTAAAGATCAAGGGAC
TCTGCGAAACCGCCGAGAACGCGGATGACCTGAACGACGCGGCCACTGCAACGATCACAGTTTCAGAGAACATACAGCAG
GCGGTCGTTGGCAATATAGTGAACGCCGCCATAGTTCCCGGAGCTCCGTCGCCCTCCTTGGAACAGCAGCAGCAACACCA
CCAACAGCAGCAACAGCAGCAGGCGCAGGAGCAGCACCAGCAACAGCAGGTGCATGCCCAGCAGCAACAGCAGCAGCAGC
AGCAAATAAACGCTGCCCTGCTTACGCAACACGGAGTGTCCAGCGGAAGTGTATCTCTTTCCGGGCAATTGCTGAGCTCC
TCGGCTAGCGGCAGCAGCGGAAGTTTAGCCGGCGGACAGCAGGCATCACAGACGCCATCCGGTTTGCAGCCGACGCCGCG
CAAGTCTCGACTAAAGCGCTCCAAATCGCCAGATTTGTCATCGGGCGGAGGAGCAGGAAGCTCTGGAGGCTCAAGTAGCG
GCTCAACGCAGCAGCAACCGCAGCCGGCGCACCACCACCACCCGCAGACCATTCTCATCCAGGGCCAAAATCCGAATTCC
ATTGTGAGCCTTCAGCAGACGGCCGACGGCAATTACATACCAGTTTCGGGTTCTGGCGACGATTCAGACGCCGAGGACCA
CGAGCACGAACACAACCACGGACACGGGCACGGGCACGGAGGACATACGCACGGACACGGTCATAGCCACGAGCACAGTC
ACGATCACGAGCACGAACATAAGCCGAACAAGATCTGCAAGACCGAGCACTCGGTGGCCTCGCCGGCGTCCAATTCATCC
AGCGCCTCGAACAATGCAGCGGGCGTGAGCGGCGTGACATCCACCGGCCAAGCCATCGTCACACAAATTGTAGTAGCGCG
CGACGGAAAAGATACAAAAAATATGACTAGTTTAGGCATGGGCATGAACGGCGGCCTGTTGGGCGTGCCCATGGGATTCC
TGGACTTCACACCCGAGCCACCAGCACCATCTGCCACCCCAGTCACCGTCACGGAGCACGTCGATCTGTCCTGCAACCCT
AGCACGGACACGCGCGATCTATCAAATACCACCGAACCGCTCGATATAGACAATCATCTGGCTCAGCAGATCCATCGGCT
GGATCAGTCCCCCATGCACTCGATATCGCACCATCATACAGGCGATGAGAGCAACTCGAATCTGGTGCAGCATATCAAGA
GCGAAGTGATCGAGGCCAAGCACCTGGCTGCCCAGCATCATGCACTTAGCCAGGCCCAACAGCAACATGCCCATCATCAG
GCCCACCAGCAGCATCAACAGCATCAGCAACAGCAGCATCAACAACAGCAGCAACATCTTCATGCCCAGCAGCTCTTGGC
CCAGAGTCAGCTGCAGCAGCAACAGCAACAGCAACAGCAGCAGCAGCAACACCACCAGCAGCAGCAACAACAGGCAGCAG
CAGCCGCCGCAGCAGCTGGTGTGCATGGCCAGCATGGGGGACATGTGACGCATGCCGACATCGGCGGTGCCACTGTCATG
GAGATTGATCCGAGCCAGATTAAACACGAGCCGGGCATGATAATAACGCCAGAGATTGTCAACATGATGTCCTCCGGGCA
TATGGACATGTATAACTCGGATACGAGTGAGGATTCGATGATGATCGCCAACGGTTCGCCGCACGATCAGAAGGAACCGC
ACTATACGAATTTGGATCAGCAGCACGGTCTGGGTGGCAGCGTTTGCGGCCCGGGGCCCGGCGGTGCTGGTGGCGGTGGG
GGCATGAGTGGTGGGGCTGGCTCTGGCTCTGGCGAGAAAGCTTTAGATGCATTAAAGAACCAAAACATGAGCCTGACGAA
AGCATCCGCCATTTATGGCATCCCATCGACCACCCTGTGGCAACGTGCTCATCGCATGGGCATCGAAACGCCCAAGAAGG
AGGGCGGCACCAAGTCGTGGAACGAGGATGCCCTGCAGAATGCCTTGGAGGCGCTGCGTTCGGGTCAGATATCCGCGAAC
AAAGCGTCAAAGGCCTTCGGCATCCCATCCTCGACGCTCTACAAGATTGCACGGCGCGAAGGCATCCGCCTTGCGGCGCC
CTTCAATGCCGCCCCGACCACGTGGACGCCCGAGGATCTGGAGCGCGCCTTGGAGGCGATACGGGCGGGTAATACTTCGG
TGCAGAAAGCCAGCGCTGAGTTTGGCATACCCACAGGAACACTTTACGGACGCTGCAAACGGGAGGGCATTGAGCTGTCG
CGTTCGAATCCAACACCCTGGTCCGAGGATGCCATGAACGAGGCCCTGAACTCAGTGCGCGTTGGCCAAATGTCCATCAA
CCAGGCGGCCATTCACTATAACCTGCCCTACAGCTCGCTCTACGGCCGCTTCAAGCGCGGCAAATACGACGTGGTGGCCA
ACACGAGTGGCGTGGCGCTATTGAACACCTCGGGCAACACCACCGGCAGCATTGAGATTATCGAGCACAGTCAGGAGAAT
TCGCAACAGTTCCCGTATAGTCCGTCGCCGCATCCGCCAACGCCGCAGCATCACAGCACGCCGCAGCACCACAGCTCGGC
GCAGCAGGGTCCGCCGACGCCGCAGCACATGCAGCAGCACGTGGTGCACATGCAACAGCAGCAGCAGCAGCAGCAACAGC
AGTCGCCCCATCCGGGCCACCATCCGCAGCATATGCAGCAGGACGTGGTTACATCGAGCAGCCAGGTGGTGCACAGCCAA
CAGCAGCAGCAGCTTCAGCAGATCTATCAGCACCACGGGACGCCGGAGCGTAGTTGAGAATCACTGCATGCTGCGACATT
AATGGGCAGCACCGGCGGTGGAGGAGGTGGTGGGGTTGGTGGAGTAGCAGCCAGCACTAGCGACGGCACGGCGGCCAGTA
GCACGCCCTTTGCCAGCATTTCGGCGCTGGTCAGCGGACCGTCCAGTGCCCCACCACCGCCGGTAACTGCCAGTGGCTCG
TCGGCAGTCAGTGGCGGCACCAGCAAGCGCAAGAAAGCCAATAAGCAAAAGCGTTGAGAGCAGGAGGATGATCAGCCACA
CAGGGAGTTGGAAACAATTGCGGGAGTGGCCAGGCCCGAGGACATCAAGTTTAGATTTAATTGCAAGCACTGGAAGCGCA
AGTTGCGGCAGTTTCATTTGCTATTGTCCAAACAGTAGTCAGTCAGTCAGTTAGGAAGGTACACACATATATGAATGACC
CACAGACAAAAAATTCCCAAGGGTAGGATAAAGCAATCACAAAACCACTTTTCAACTAGATGGACATTAATTACACAACC
GAGATGTGTATAAAATGTAAATATATAACGAAATATGCTTTATTTACATTATACGGAACATAGTTATATAGGTTTTAGGT
TCGCGAAAGTCCTTTGTTCTAGTTAGGTAAGGTAAGGTGGAGAAAGAAGAAAGTTAAGAAAACATACCTTGAACGTAAGA
GAATGATGAATTTTAGATTTGCCTCTAGACTCGAAAGTTAATGGATTCGTTTTGGGCTCGCAGTTTTAAGAGCACTTTGT
TATCAATGGATATAGACACGCGTATTTATTTTGGTCTCGCGACCATTCTGAGAACCTTGAATCGGCAGTTGATTGTGGAA
TTTCGAACTAGATTGTTTTCCCTTCAATGTGCTTATGTGCTTTGTTATAATTTTCGCTTAGTGTGAGACTGAAAGTGCGC
CTAAAACTGTTGAAAAACCCCATGCCCAATATTATAGTGAAGACGCATAAAACACAACCCATACATGAATCAAATGCTTT
ATAACCATATTGTTTGAACAGATAGAACGAAGTGGGAGAATACCTTAACGTAGAATTAAACCAAATTATCAAGGTTCTAG
AACTTAAATCATTAGCTTGTAACGATAAAAGAAAGCAAAACGAGTTATTTGAATTTTACTGGAGGCGTCCTGAATTTTGG
ATTGTATATTGATTTGATTTCAACTGAATTAAGAATATAGCCAATAAATAAATGTAGAAATGAAGTAATTGCAAGGAATC
AACAAATGGAATGTATTTTTGAAAGAACCGGAAACAGAAGCAGCTGAAATTAGCGAATCAAACTGCAAATGTTGTTAATA
CTAAGCTCTTAAATAATGTCCTTTGAAGTCACATTCAAACAAAGATTTAAAACAAGCTTGTAAGAAAAAGAAACCAATAA
ATACACACGTATATATATGGATACAAAACACCTCTAATTGAACTGTAAAATGTCTTAGTGTAGCAGAGAATGAAAGTAGT
TATAGTATACATTTCTTTAAAAAGCATTATTCGAGCGAGTTTTGGATACTACCCTTCGAATCCGGGGTAGACTTGATTGG
TCTATATAAAAATCCGACAACAAATTTACCACAATGGGAAATATATTCAAAATTTTGAATTAGAAATTTAAAAACGATAA
AAAATGTATAATAGCTTCCACTAGCGTATCTACATATTTAGGAATCGGAGGAATGGATACACCTAGTAAACACCCATCTG
AAGAAACTTCAAAACTTTTTGGTTTCATCTCAACTATGCGTGTGCGGCGAGCACTTGGATATCTTTGTATATACATTTGA
ATAGATTTTTTTAGTTGTTAGCTGACCTAGGGGAACAGGTATCTGAATATTATAAAAATCAAATGTTGCAAATTAATTTA
TTTTAGCGTTATAGACCCGTAGAACTGAATGCAATATGCTTACCTTAAAACTCAACATAATTTAATTCAATTCCTATTAT
CTTTAGTTGGATTCATTTTAATGTTTTATAGCAAAACTGTATATCATTGTAAAATAATTAAAGCATACGGAGTAGCAACT
ACAAGAGTTAGAACAACAATAAATGAAAATATCATTATAACTTTGTTAAAATTGTCGCAAGAGCAATTAAAAAATGAACC
CAGCAACTTGAAGAATCGAAAATGAAGGCGAATCACAGAAACGTAAAAATAATAAAAATATTACATTTAAAATTTTAAGC
TAACTAAATGTGTAAGAGTAAACTTTAACCACACAATATTATAGCACATTTCGGATTATCAAATATGCATATACAGCAAA
TATCTATTATAAACGGTAAATGTAAACCCAAAAAGGAAACACTGAAACAATCTATGTAACAGCCGAAATAGCGAAAACAA
CCCATGTAATAAACAAACAACATTTAATGTAATATTGGTATAACGTAATTTTTAAAGTGAGGTACTATAAATAAAAATTA
TTGAATAATTACATAA
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0088276
5313
FBtr0088275
5367
FBtr0088282
5210
FBtr0088278
4725
FBtr0088277
4464
FBtr0088279
4780
FBtr0088280
4513
FBtr0088281
4550
FBtr0100606
4889
FBtr0100607
4640
FBtr0330607
6336
FBtr0479799
6336
FBtr0479800
4725
FBtr0479801
4725
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0312422
1043
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0087369
1046
FBpp0087368
1064
FBpp0089330
1064
FBpp0087371
645
FBpp0087370
645
FBpp0087372
645
FBpp0087373
645
FBpp0087374
645
FBpp0100066
639
FBpp0100067
639
FBpp0303457
1123
FBpp0428132
1170
FBpp0428133
725
FBpp0428134
772
Comments

Extended 3' UTR based on RNA-Seq and/or EST data.

Extended 3' UTR based on RNA-Seq data.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
psq-RN
Secondary FlyBase IDs
    References (0)