Open Close
General Information
Symbol
Dmel\fal-RD
Species
D. melanogaster
Annotation Symbol
CG9670-RD
FlyBase ID
FBtr0347258
Feature type
Associated gene
Evidence Rank
Length (nt)
2128
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 71 )
Sequence
AATGTTTTCTCTACATACTTTACAAAAAGTGTATTATTAAATTTAACAATGAAGTGATACTGGCACATATTTTGTATTTT
TTCTACATTCGCGTCTACGTCAAAATGAATAGCTTTACCGTTTGAAAGCGTCGCCATTCCTGTGCAGCTTTTATCGCATC
CCTGGTCGATAGCTGCAATCAGCTGTGCGCTACCATCGCCAAATTTACAGTTGTGTACGTTCTGCTTGACGAATCGGAGT
CGCTATAAAATGTAAAAAAATACCCGGATGTTATATATTCGCACAAATCGGCGGGAAGACAGCCTTCAAGACGTCGTGCT
GTGCGCATTTTCGGGTTTGCTTCGGACGCGGATTGTCGATAAGCAGGAATCCAATTAGAATGTCAGCCAGCGCAGTGATT
CACTCCCTCGCTCAGCGACGGCGCTCTCTTTCTCTTCCCCTCTCCAACGAACCAAAGAACTCGAAACTCCCGCTTTCCCA
ACAACAACTACAACAGCAGCAGCATGGACACCACGAACAACAACAACGCCCATCTATGCTTATTGAGGATGAGGTTCACG
GTGTAATCGAACTGTCGAGCCATATCCAAGAGATCGTCGAGCATCCACTCTTCCAGCGCCTCAAACATGTCCACCAGTTG
GGTCTCCTTCCGTGGGCCATCGATAAGAAGGCCGATCACAAGCGATACGATCATTGCCTTGGAGCCTACAAAAGCGCGCA
GGATCACCTTAGGGCCATCGAACGTAATTCGCATTACGAGCCAAAGCTTCCGGATTGGTGTCGTCAGGCGGTGGAGATAG
CCGCTCTCCTTCACGACATTGGTCACGGACCAATGTCACATGCCTGGGAGTTGGTGACCCACCATGAATTTGATCACGAG
GAAAACGCAATGGCCTGTGTGGATAAAATTTTTAAGGATGCCCTCAATCAGGAGCTAGTCTCCTTGAGAGATGATGGTGG
CGGGCGAGGTGTTCAATTGATAAAGGCTTTGATATTGGGATCCAGTGAGAATCTGCCGTTCCCCATGCTGGGACATACCT
ACATCTTTGATATTGTGCATAATCGTCGCTGCGGATTGGATGTGGATAAATGGGATTATCTGCGGCGTGATAACAAGCGC
CTGAAAATACTCAGCTCTGCGGAAATGGACTTTGATGATGTATTTCTTCAGGCTCGCATATCACCTGATGGTCAACGCAT
AGAGTATCGTTATGCTGACTATCATCGGGTATATCGCTTGTTCGAGGCGCGATCGCTGCTCCACGTAAAGGCCTATCAAT
ATCCGCTAACTTGTGCCATGGATGTTATTTTTGTCAGTGTAGTACAACGTATTGCTCCAGAACTACTAAGTATTCGCTCA
AAGGATCCAAAGTGGCTGGAATTGACCGACGAGTATGTTTTAAATGTCATTGAAAAGGATCCTATATCGAGATATGTAAA
AGAACCTCATCGACTCGTAGAAGTCCCCAGCAACGACTGTTCCGGATCGGACATCATACGGGTGAACAGGGTCATACCTG
GACCTTGGGAGCTTATAAAATCCGCAAGGGAGTTAGCTTTCTTTGGCAATAAGCGCAAGAAGCGTCCAATTACCCGATGT
GTAAGCCCGACGATAGTCAACAAGTGCTTTAAGTTAGAGTAGAAACATCCACCAGAGAATAGTTCATGTTAAGTCAACAA
ACAAACGTATGTTATTGTTTCCATTCGCTTCGTTTTCTTATATTTAATAAACTATATTTCATAAAAAGATGTACAAATAC
TCCAACGGTTGCGTTCGTAGTGCGGCCATTCTTATTGCCATTTACATTTTGTTATCCAGCATAGTCGTTGAGTTTTTTTT
AGTTATTTAATGTTCTTTATTTTTATTTTTCGTTTCCATTTATAGTTAAAACTGTGAAATCAGTGGAAAGACAATATGTT
CTTAAAATATTCATTTATTAGTTTATACAGTGTTTATCATAATCGACTTAAAACTAAAATACTAAACCAAAAATTTCAAC
AGTTCACTTGAAGACATCACAATTCAAACTCAGGTCTTTATAACATAAGGTACTTACTAATCTATATAAATATAAGATGC
ATTTGTCATATTTTTGATAACCGCTTTGAAATATACACAAGAGAAAAC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0290284
1925
FBtr0321324
2519
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0312519
368
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0288723
368
FBpp0302865
368
Comments

Extended 5' UTR based partly on RNA-Seq and/or EST data.

Transcriptional initiation is supported by RAMPAGE TSS data (FBrf0220331).

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
fal-RD
Secondary FlyBase IDs
    References (0)