Open Close
General Information
Symbol
Dmel\Wnk-RO
Species
D. melanogaster
Annotation Symbol
CG7177-RO
FlyBase ID
FBtr0347540
Feature type
Associated gene
Evidence Rank
Length (nt)
7916
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 21 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      GTAAAATTTTTTGTGAAAGTAAAGGGAACTTCTGGCGAAATAACTTCAATTTTCCGCTGACTCTCGCACGCGTTCAATCC
      AATTGACCCCCCTTGTGGAGGTGACACTATCTCCCGAAAGACTTACCAATCCCCCGTGCCGTAATATGAAAGCTTGCTAG
      CTCGAATTGCCTTTGAACACCACAATCACAAATTGAAATCCTCGATGCGAACGATCCGACAGTCGCAGTGCGAGCCCTAG
      ACCCCGTCCCGGTCGTAAATCCCCAACTCGAGCACGATCCCGTCGAGCGAAGGACTTCCGGAAGGAGCGGCGTGGAAACA
      TGACATCATAGTCGCTGCATATGCTTCCTGTCCCGAATCAAATGTACATAAATATATTAAACGTGGTGGTCTGCTGCTAA
      AAATCTTGCAAAATTGGACAAACCCTCTGCGACTTCGTACGACAACAAGAGGTCGTACCTGCGAACCGTGCTCGGAAGGG
      AAGCGCCATCAGCGAAGATGGTACTACCTCCTGCACCACGCAACCTCAAAGGAATACCTCAATTTCTAGCGAGGAGCAAA
      CTGTGCAGGGAGCTAATATACAAAAGTCGGGACACCGTTCGTTTAATAGATCTGCCTCCTCTAGGCAAAAGCCGAACCCG
      ACATCAAAACTAAAAGACACACTAAACAGAAAGCCCACTTGCAAGCAGGGCACACTTTCTGCACACACGAGCACTAGCAG
      CACCACTTCAATCCAGTCATCACCTATCGAGCCAGCTTCTTCTCTACCCACGCTGAACACCACGCCTACACCACCAGCTG
      CCAGCAAAAGTAACCTATTTGTGCGGGTGCTAAGACGCTTTTCAAATAACACCCTTCCCGGCAAAACGGCGTCAAGCCCG
      AAAAACGTGGACGACGTACCGAAAGTCAACGATAACAACAACGGCGATTTAGGCAAACAGCAATCAACCGATGTAGAGGT
      GCTTTGCTCTCAGGACAACCAGAGCAGGGAACAGAATGAGGACGAAATGGATAGCAAAATAGAACCTGCAGATGCCATAA
      GCAACCAGAAAGCTGGTCTTACTTCGGGCAAACCTAAAAAAGACAAGTCAGTCAAGGGGACGTCGCAAGCGGTTGTTTCA
      GACACCAAGAAAATGGAGGCCAGAAAGTCCTCCTCGGACACGGTGATCGAGCCATTGATCAAGCAGCAGGCGCCACTGCA
      CTCGTCAAAGACCACGCCAACGACTTTGACGGCGAACTTCGTGCAAAACATTCGATTCGTCCGTAAAAATGTGGAACAGT
      CAGGCAGGAACACCAATCCACTGCAGTTCGTTGAACTCGAGACAGAGTTTCCTCGTGACTATGACGACAACATCGAGATG
      CTTTCCCGCGAGGCGGAGCATCTGGAGGAGCAGTTCCGCACGCCTACGCGCTCCAATGCTACGGATGCCACTTCCCACCA
      TGTGGCCGGAATCATCGACAACATTATAACCGAAGCGTCACGGAGTCTTACAATCGAAAAGACTGAAGACGATGTGCCAT
      TGAAGTCTTCTACCAAGCACTCAAGCGGCGTAAAACGAGTTGGCTTTCAAGTAGAGGATAAGGACGATACCGAAGTTCAG
      AGCGAAAAGCAGGCAAAGAGCTTCGACGACATAACCAAAAAAGCGGAGAGCTCCGAGGCTAGCGCAGAGGAAGCTGCTGT
      CACCGGGTCCTCGACAGATGCATCTGCATCTCCCCTGCCCTCCACGTCGCTGGTCTCCACCACATCTTCAGCTACATCGA
      TAACCAAGAGTAAGAGCGATGAGGACGATGATCCGGTGGCCATGTCGCCGTGCGGACGATTCTTTAAGTACGATAAGGAA
      GTCGGACGCGGTTCCTTTAAAACTGTCTATCGTGGCCTGGACACGTTGACTGGTGTTCCAGTTGCCTGGTGCGAGTTATT
      GGACAAGCAAGTAAAAAAAAGTGAACGTACTAGATTTCGCGAGGAGGCAGACATGCTGAAGAAACTTCAGCACCCAAACA
      TAGTGCGGTTTTATACATATTGGGAGTTTCCTATTGGCCGCAAGAAGAATATTGTACTAGTCACCGAACTAATGTTATCT
      GGAACTTTGAAATCCTATTTGAAACGATTCAAAAAAATACACCCAAAGGTATTGAAGTCATGGTGTCGCCAGATACTAAA
      AGGCCTTAACTTCCTGCATACTCGTCAATTTCCTATAATTCATCGTGATTTGAAATGTGATAATATTTTTATAACTGGCA
      CCACTGGTAGTGTTAAAATCGGCGACTTGGGCCTGGCAACTTTGAAAAACCGCTCCCACGCGAAATCTGTGATTGGTACG
      CCGGAGTTTATGGCCCCGGAAATGTACGAGGAGCACTACGACGAGTCGGTGGACGTATATGCATTCGGCATGTGCATGTT
      GGAGATGGCCATTTCCGAATATCCTTACAGTGAGTGCAAGGGTCCTGCACAGATCTACAAAAAGGTGATATCGGGCATTA
      AGCCAGCGGCGTTGGCTAAGGTGGAGGATCCCAACGTGCGCGACATTATCGAACGGTGCATTGAACTTAAAAAGGAGGAT
      CGCCCCAGCTGCAATGAACTGCTAGAATCGGAGTTCTTTGACGAAGATATCGGTATACGAGTGGAGCCAACTGCTTCGGA
      GCAGTTCCTTTCTGATCCGAGCATCAGCATCATCGAGTTCCGACTGCGGTTTATGGATCCCAAGAAGCGCTCGTCCCGTC
      ATAAGGAAAACGAGGCAATTCAGTTTGAGTACAACATCAGGCATGACGAGTACGAACAGATTGCGCAAGAAATGATGAAG
      GAAAATATTATATCTGAGGACGACTCTCGCGCTGTAGCTCGGCTTTTAAAAGTGCAGGTGGTGTCGTTGCTTAAGGAACG
      TGCCCAGCGTCAAACTCAAATCAAGCTGCAAAACGAGAAGTCTCGTTTGGAAAAATTGGCATTGCAAAAGCAACGTGAGA
      GTTTGCCGACTAACGTCGATGAAGACGAGGAAGAGGAGGAGGAGTCCGAGGACGAGGAGGATGGTGTTAAATGGAATCAG
      CGCCTGCAGCTAAGATATGACCTGCTTAACACTGATTCAGAAACAAGCCTGGCTCTATCCACGAACAGCGTCGAACCGCA
      GCAGCTGTCCACTCGCTCGAACACTTCGATTCCGAACAGTGGCATTCAGCAACCTGTTCAGGTCCCAGGTCAAGTGCCTG
      TTTCCCAGTTGATCTCGGTGCAACCACAGGCTATTCCGTCACCGGCTATTCCCATGCAACAGAAGCCGACGGTGCACTAC
      ATTCAACCGCCACAGCTGGCCTCTTATCAAAATTCGAATGCATCGATGCAGGAGATGACCAATAACCAGGTCATTTCGCC
      GACAGGCAGTCAACAAATGCAACAGCAACAACCCGTAGTGGCACCAACAGTCAATCATCAGGTCATGCCGCAGCAGCAAG
      TGAACCAACAACAGCAACAACCACAAATGATGCAGCAAATACCCCAGCAAGTTCAAGTGCAACAGCCCCAAACTGTATTG
      CCTCCGCAGCCACATGAGCAGCAGCCACAGCAACAACAACAGCCACTGCAGCAACAACTGCAGCAGCTTATGCATACTAA
      CGTGCAGGCTCCGGATTTGACTCAACAGCAACAAATGGCTCAGCAACAGGCCCAGCAATATTTTCAGCAGCAGCAGCAAC
      AGCCTCAGCAGGCCGTTAACATGCAACAAGCTTATGCAATGCAGCAAGCTGGCCAACAGCAACAGCTTTCGCAGCCTCTT
      CAAATTCAGCAACAGATCTTGCAGCAACAACAAGTGGCCGTTTCACATCAGCAACAGATAATGCAGCAACAACTGGCCCA
      GCATCAGCTGCAACAGCTGCAGCAGCAGCAGCTTCAACAACAGCAACTGCAACAGCAGCAGCAAATACAACAACAGCAAC
      TCCAACAACAACAACTCCAGCAACAGCAATTCGTACAGCAGTATGCGCAGGCAATGCCTCAGCAACAACATCAGCAACTC
      GTTACGGGATCGCAAGTCATGGCACCGCATCAACATCAGCAACCTATTCAGATCCCAGTGCAGATGCAAGTTCCACCGAC
      GTCCGTGGCTCCTCCAATACAACACACTTACAATCAGCAGGGCGGACAAGTAACGCTCAGTGATGCCCAACAGCAACAGC
      ATCCTGGATTCTCGGCCGTACCACAACAGGCAGCGCCATTTATACAACAGCCCACACAGCAACCCATTCAGCTATCAATG
      CCTTTGGAACAACAATTGCAGCAATTGCTGCATAGCCAGCCAGCCCAGCAACAACAGGCCATGAGCCAACAGCAGCAACA
      GCCCTTGGTGCAACAGCAACAACTGCCTTTGGTACAACAGCAGCCGCCTTTGGTCCAGCAGCAGCAACCGCTGGTTCAGC
      ATCAGCAGCCTTCGGTCCAACATCAGCAACCTTTGGTGCAACAGCCCCAGCAACAGCAACCACAGCCCCAGAATCAGCAA
      CCACAGCCCCAGACACAGCAAACACACGTGGTTCAGCAACAACCACCACAGCAGCAACCTGCAGTAGAGCAAATCTCACA
      GATTTCTTCGCAAGTGCCTGTTCAACAGGAAAATCTGCAGCCAATACAGGTCAACAAAGATGCGAATGTCGCAACGGATG
      CAATGTCCCTAAATAGCGCCCACGGTGCCCTCGAACCTGCACCGAAGACCGAACCCCAGAACTCTGCTGATGCGGAAAAG
      CAGCAAAAGCAGACAGGCACGGGCACACGTTCCCAGAAACCGAGGCGATCAAACCGGAGCGGCAACGAACGGATTCCCAA
      ACTTAGTGTAACCAGCGTCGACGAGGGCAGCGTCATAAACTGTCACATGGAAAATAAACTTAAAACGATTACATTTAAAT
      TCGACATAGGAGACGTAAATCCGGTTGAAATAGCCAATAAATTGATCGCCCAAGATTTGCTTTCTAATTGTCAAAGTACA
      GTTTTTGTGGAAATGATCAATGAAATTGTTGACCAAGTCAAACAGAATCCCAATCAAATCCCTATACCGACAAATTATCG
      CCGCAATATTGAAAAGCGGGATGAAACCGCCAGCGACATCACAAAGATGTTCGAGCCCACTATCCATGGTGTTGAAACCC
      TGCCATCCGGTGGAGGAGGCGCTGAACAGTCAAACTGCAACTTGACTTTAGAGGCCAGGTCCCATTTATCCAACATACCA
      AATGCGAAAGAACCACAGCTGAACGTCAGCACTCCGCCCACAACCACTTCGACTATGTCTTCCTCATCAACCGCATCGAG
      GGATGCGCCCAATAGTAGCAATGACGTGACCATCGGCTCTGGTTCCGTTTCTCGAAAAACGAGCACGGCCTCGGAGTACA
      CTTCGCTATCGATTGACTATATGCCCGACAGCAACATTACTCCAACTGGTCCGGAGCCACCGCTTGACGATGGCAAGGAT
      AAAAAACCTTGCTCCCTTGCTATAGCCAGAATGCAAAAGCTCTTGGAGTCGGCCGGCAATGGTGCTCCTCGCAGCCTGAA
      TTTGCCCTTGAATCGTCACCTGAAAATTCAAGAGGACTTGAAGCATACTAGAAGTCTTGACGATTTGACCGCAGTGAAAA
      TAACCTTTGACATGCCCAACAAGGCTGCATTGGACACTTCGGAAAACGCTCAGCAGGCCACAGAAGCGGAAGCGGAGAAA
      CCAAAAGATAAATCCGGACAGGCAGTAGGCAACCAGGGAACTGGAGCGGCCAACACTCTAGAGCAGTTAAAAATAGAACT
      GGAGAACATTACTCATGCCCACGCGTTTGCCTCCGCTGTAGTGGCCTCGATTAACAACAGAGCTCCTCATCAAGCTTCCC
      CAGCAATGTCCTCCCTAAAGGCCACTTCTGGACAACCACAGACACAAGAGATAACCAAGCCAAATAACGGAGCAGGCCCT
      TCAGTACCCTCAGTGGGTCAGAATACTCCCACTGCAGCCTTAACATCCGCCAGGGGCTCAGGCTCCTCCGTCTACAACTC
      ACGTCGCACATCCATCGACAACAGCGTGGGATCCGACATGCACCTGCACACTGCCACTAATCTTGAAGGGACAGTGAGCA
      ACCCGGATCCGATCCCGACTGAGGCATCGGTTGGAATTACCATTGCTACGGGTCATGAGAAGCAACTCTCCAAGCAGCCC
      AGTTTGGAAAAGCCTTCTGCCACTTCCATTTTAACGAACAACAGTGATCCTCCGCAAAGGAATCCCAGCAATGGATCAAT
      TAACCAAAATTCAATAGCTGATTTGGAAAAGAAATTGGCAGCTTTGCGAAATACCGAAAACACAGAAGAGTCTGCAACAG
      CAACGTTGTCAGTGGTTCCTAAACAAGTTGAAGAGGTAGTCAATCCAAGCGCGCGTAAAATTTCGCGTTTTAGTGTCAGT
      CGTGTGCAGGAGCAGAAAACTTCAACCGGAGTTGAGGAACCAGCTCAAGGTCAACTTAAGATCGACCTCCAAGTCGCCGG
      CCCTGGAGGCCAGGTGCAGACCAACAACTCCGTTCAGAACGGCAGCGTGGTCAACACTCCAACCGAAGTCATCAGCTCTC
      CTATTCAAAATGTTCCGCTGGCCATTAACGGAATTCAGTTGATGTACCAACAGCCCCAGCAGATACACCAGTTGCCAGGT
      GGAACATCAACTACTACAAGTGGAGCAGGGACTCAGTGCATTGTAGTGCCGCAAGTGGTCAATCAAAATGGCACCCACGT
      GCAACAGCCGTCTAACCTACAGCCACAGCAGCAGAGCGTACATCCAAATATGACTCAACAGCCACAGCAGACGCCACTTA
      ATGGGCACCCATCTATGGTTAACACTCTTCAGCAGCAGCCACCACAACAATCCTTACCGATGCAGACGATTCAGTCGCAG
      CAGCAGCAGCATAACCAAATGCCTATCATTTCGCAACAACAGCAGCAGCAGATCCTAATGCAGCAGCAACAGCAACAGGG
      ATCCCAGCAAGGATCACAGCAATTTAATTTGCCTGGCACACAACAGACTCATCCTCAGCACCAGTTCATCCAGTCGCAGC
      CCAACCAACTTCACTCGCTTCCGCCCCAGGTAGTGAGCATGGCTCAGGGAAATCTGCCGCATCAGCTTCCACCCATGCAG
      ACTATGGGAGCCCAACAGCAAATGATCTCGCAACAACAGCATCAGTTGCAGATGCAGTCGCATATGCACCAACAAAACGT
      GCCCGGAATGTACAACCAGCAGACTGGAGCTCGTGTGGCAGCACCCCAAAATTTCGCAGGTGCAGTTCCAAATCATTTGT
      TGCAGCAGTCCCCTTTGATGGCATCCCAGCAGCCAGCACAGCCCATGCAACACGTTATGCAACCGATTTTCAATGCAACG
      TCCGGTGAAGTTACCGAAGAGCCTGTCTCTTTAGCAGCTACGCATCCGCATCTGCTACCGAGCGATATTCAATCCGATAT
      AAAGCACAATTTAGACTCATTAGTGAACCAATTGTGCAATACGCGCTTGGGTACTAACCAGCACCAACGGCTGTTGCTGT
      TGCGTCAGAGACAACTCATCGAAGAGGACGAGCTGCGTCTTAAACATTATGTGGAATACGAAAAGTTCCAAAAGGCACTG
      CGCCAATCTATTAGCACAAACGTTCCAGCTAATGCAGCTTACTATTCTGCGGCTGCCGCACAGCTTCCAACTAATTTGGC
      AGCCCCAGCAGCTCCGTCCTCATCGAATCCGACGTCCACTAGCTCCGCAAACACATAACTGCTCTAAATGTTTAGCTTCA
      TGCACTTTTGGCAAGTCATACTAACAGCTCTACTCTATGTTCTCGGCAATATAATTGGCACGAGCGAAAGGACGTGGATC
      TGGAGATAGATTTTAAGTAAAAAGTTGTCAAATGTTACGGGGTTGTCTGTAAATATTAGTCAAACGCTTCTTGTTG
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0346817
      7916
      FBtr0346818
      8089
      FBtr0346819
      8199
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0312580
      2243
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0312392
      2441
      FBpp0312393
      2462
      FBpp0312394
      2441
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      Translation start supported by Sato and Jenny, 2014 (FBrf0226488, personal communication to FlyBase), and by FBrf0226256.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      Wnk-RO
      Secondary FlyBase IDs
        References (0)