Open Close
General Information
Symbol
Dmel\pre-lola-G-RC
Species
D. melanogaster
Annotation Symbol
CG44025-RC
FlyBase ID
FBtr0347596
Feature type
Associated gene
Evidence Rank
Length (nt)
2967
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 41 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          GCAGTGTTGATTGTGTTGCCGTGTGGACGCTTTTTGGTGCTACACATTTGCGGATTAACACAGTGCTTAATTTAAATCAT
          TTCATATATAGCTAATCTATTTTTTTTTCTATTTTCTAGATGGCTCAGGTTATGAGTTATTGTAAAACGGTTTTGGTTAA
          AAAAAAAAAAAACTCACCCATCACAAAAAACCATCAACACACATCAGCCACACCATCAACATCCATCATCAAACAAAAAT
          CAATGTGTTCATTTGCCGAGCTTTTCAATTTTATTTGTTTATGCCAAAGATGTGTTTACCGAATTAATAAAATTTTTTAC
          AATGTGTACTTTTATTTGTTTAATTTTAAAAAAATGCGAAATTATGCGTTTTGCTTTACTTATTTATTTACTTGTAGTGT
          ATTTTGCCTATTTATTGCATGCCATTCATCTAACAACATTTTTTGCCCTAATCCCAGCAGTCCCAGTGTTAAAACTTGCT
          TTTTCATTTGACGCAGCTCAATCCAAACGATTGACATAGACCAAAGCGAAGGAACTTCGAACGGAGTGACTTGAACGAAA
          AAACCCAGAAACTAAATTAACCAATCGCAACCATGTTTCCAATTGCAGATTTGAGCAGGAAGGAGAACACCGCACCCGAT
          GTGGCGTCCACCGCCGAGATTCAGCGCAGTTTCCAGCGCAGCATTCTCAATGGCAAGCAGCGGGATGAGCAGAAGATCCA
          GTTGCCCGGATCTCGGCGCAAGCGCTTGTCCGTCACCGAGGTCTCCGACATGCTGTTCGAGTTCTACAAGACCAAATCGG
          CCAAGGTGCCCAAGGCGGAGCAGCCGCACCGTCAGGTCTCGCCGACATCCGGTGAGATCCTAGATCCCTCGACCATTTCG
          GCCATTGCCGTTTATGGTACGGCCTCCGAGACGGCCTCAAAAAACTTGAATGCTGATGAAGTGATGCGAGTTCAGAACGC
          CACAGCTACGCGTGTGGTGGGTGCTGCCGCTGGCGCCGCCGCCTCATTTCATCCAAGGCCCAAATACACCCTGAAGACAG
          CGGCATCGTCCACGGAGCATACCACGGCCATACCCACTTCGGTGCTGGTGGCCAATAGTGCGGCGGCTCTGACTCCGAAA
          CCGCAGGCAGCCGTAATTGCCGAGGCCCTGATGCGAAATGGACTGCACAACTTCCAGCAGCAGTTGCGTGCCCAGGAGAT
          ACTGCGCCAACAGACACCCCATCGTCGCATCAAGGAGGAAAACGATGTCGAAATCGCTGGGGGCGACATAACACCCACTA
          AAATTCTGGAGAACCTCTTGCGAAAGCAGCAAGAGCGCGACCTCCGCCACTCTGAGTGTGAGAACGAACCGGGCTATTCG
          ACCGAGGACGACGAAGAGGGTCGCTATCATGCCTTCGATGACATACACCTGATGGAGCAAAGCGGTGGCAAGTTCGGCAA
          CAACTCCGGCATGGGCATGTTCAATGCCAATGCCCATGGAGGATCGGCCAGCTCGATTCTAGATGCCCATCAGGCCTTCC
          GCAACCTGGAGTTTACACTCAGCGATTATGGCGGCAGCAGCAGCAATGGCAGCACCACCAGTCCCAATGGCATCGGCCTG
          GATGGCGAACCCGTATACGAGTGCCGTCACTGCGGCAAGAAGTATCGCTGGAAGTCCACACTCCGGCGCCACGAGAATGT
          CGAGTGTGGCGGCAAGGAGCCATCGCATCAGTGTCCCTACTGCCCCTACAAGTCGAAACAGCGCGGCAATCTCGGTGTCC
          ATGTGAGGAAGCACCACACCGATCTGCCCCAGCTGCCCAGCAAGAGGAGATCGAAGTACTCGATGAATCGCGAAAACGGG
          ATGAGCGGCTCCATGTCCGATGACTCGCAGGGCAAGCTGATCATCGACTTCAATGGGAAGGGAGAGCTTGAAACCAAATA
          AATTTGTACGGGGACCGAGTGATGCTTCCATTTGATATACAATATATTTTACGTCTGGTGTCTTGTTTTGTCCATTGGAT
          TTGTGGAAATTTATTTCTTGTCATTCATGTGTCATCCCAAATATTTAATGTTTACTTGTAGTAATTTATGTAATGTAAGC
          AAATGCAAGCCAATCTAATCAAGCATATAATCAAATTAGTCTTAAAGCCTTTTTTCTAACGATGCATTTATGCGTTAAAG
          CATCAGTTAATATCTCTTAAATTGTATAAAATGATCATTCACCAAATGTCAATTTTATACTTACGATTAAGTGTGCAAAA
          TATTATCAAACAACACTCAAATATTTTCTAAGGTCTCTACTATTTAAGATATCACGATGTTGTCCAGAAAAAAAGTATTT
          AGAAAGGGTTCGCCTCGCCGTGTGCGTATTTCCAAAAAGTTCCCAGCATCTTGCCCAGAAACCCTCTGCCATCCAACGAT
          CTCTTGACTTGGCTTGATTAAGCTACTAAGACCAAAACTTTTGGTAACTACTCGATAAGCTCAATCGATGCCATTTACAA
          TGATATACATTATGACTGAATTAGTTAAGAGAATTGCATTGAACTGACAACTGAACAAACCATTAATTAACCAATTGAAA
          ACCAACTATTCCTCGCCCTGAAGACATTCGTTTCATATATTTATGGACTTTAAGACTGAGTTTATTGTATCTTAAAAATT
          ATTAACCCATGACCAAAAAAAAAACAAAAAAATTGGAACATTGTACGATTCCCAAACCAAAAACCAAACACTTATTATGC
          CTAAATGTTTTAACTGATATTAATGTTTGTATCTTACCATTAAGCTTGTGTGCCGTCACATTGAATCGCCCGATATTTTA
          TGATTGTATACTTAATAAGATTATAATTCCTAACTGCATATCACGTGGTCTTCACCGATCGACGAAGACACGATTACGAA
          CTGTGGGCAGTGTGACTGCTAAAATAAGACATGATTTTATAATGAACTTTTCATATACAATGTTTACATTTTAAATAAAA
          CGCAGAT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0347597
          3359
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0312609
          436
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0312610
          436
          Comments

          Transcriptional initiation is supported by short-capped RNA data (FBrf0209722).

          3' UTR based on RNA-Seq data.

          translation_exception: trans-splicing precursor

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          pre-lola-G-RC
          Secondary FlyBase IDs
            References (0)