Open Close
General Information
Symbol
Dmel\mir-305-RB
Species
D. melanogaster
Annotation Symbol
CR43032-RB
FlyBase ID
FBtr0472743
Feature type
Associated gene
Evidence Rank
Length (nt)
23
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 0 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
          End(s) extend beyond the annotated transcript, internally consistent
            Sequence
            CGGCACATGTTGAAGTACACTCA
            
            Other Products of this Gene
            The Precursor miRNA
            Name
            FlyBase ID
            Length (nt)
            FBtr0304497
            73
            Other miRNA Product(s)
            Name
            FlyBase ID
            Length (nt)
            FBtr0304498
            23
            Comments
            External Crossreferences and Linkouts ( 2 )
            Crossreferences
            miRBase - A searchable database of published miRNA sequences and annotation.
            RNAcentral - A comprehensive ncRNA sequence collection representing all ncRNA types from a broad range of organisms
            Synonyms and Secondary IDs (3)
            Reported As
            Symbol Synonym
            CR43032-RB
            dme-miR-305-3p
            mir-305-RB
            Secondary FlyBase IDs
              References (1)