Open Close
General Information
Symbol
Dmel\nAChRα5-RI
Species
D. melanogaster
Annotation Symbol
CG32975-RI
FlyBase ID
FBtr0474155
Feature type
Associated gene
Evidence Rank
Length (nt)
7755
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 6 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CAATGCTGCACGGGCATCGGGCTCAGTTGGTGTTCCGGTTTCGGGTTGTGCTGTCAGTTGCCTTTTTGCACAGCGGCTGA
          GCGATTGAGCGATTGAACGATTGAACGGTTGGACGGCTGAGCGCTGGAGCGGTTGAGAGTGTGCCATCGGAGCCGGAGAG
          TCCTAACGCGTTGCCCGTGGCCTGTGTCCGCATCCGTATCCGTATCTCCGTGCGTCTCTCTCCGGGTGTGTGCGTGTGCG
          TGTGGTTAAGTGTGTGCCTGTTGTCTGTCGCTAACGGTGCGCGCGCGTCTGTCTGTCCGTCGGCACGCATTCCACATGCA
          ATGGATGCCAGAACTAATAGCGGATATTGGAATAAACAAATATAAAATCACATACATACAAATTTATAAGCTAAGCAATA
          TTTAATTCGGTTGAGTGAAATTCACAAGAAATAAATCAATTTTAAAGTTCTTCAAGCTGCGGAAACAAATACTAAGCCGC
          GAAAACTATTTAATCGCTGAACTGAATAAACGCATAAGCCCACGACTAAAGCAATTTTGTAATTAAAAAAAAAAATGGGA
          AACCAAACTGAAAATACTAGTTATTAATTAATGGTGATGGCTACTCACAAGCAAACTATTTGAGCCAGTTGTAAATATTA
          ATAACATAAAATGCATACACACACCCGAAATTCCAAACTCACGTAATGTCAAGAGAATTATAATATCCATACATAAATAA
          TACAAATATAAAATCCATTTAAATACAAAGTGTTCTATTATATAGAAAACTAAATTCGCAAATGATGTATAAGTTCTCGA
          TAAGCAACTGAAAAACGCACAAGATTGATACAAATTTTTAATAATAGTACATTAAAACATAAGGACAGTTCAAGCACAGC
          TCAATTGGCTGATGAATCTAAGTGAAATTGAAAAAAGTCGAATAACTCGATACATACATATACATACATAATCGCATATA
          AATAAATAATAATCATTATTGAATTTAAAATAAATTACATCAACTTCATTACTTATCAAACAAAAATTCTGGGAGACAAA
          TTTGATAAAAAAAGTTTAAAATAATATTAATACGCATACAACAAGTCTAATAAACGAACCAGTAAAGGGAATAATAGTTC
          GACAAGTAATTATTCAATACAATCAACGCAATCCTTGAATGCCAATTGGAAAAACCTTTGATTGCATAACAAATGGAGAA
          GAGATAGAAGCAGCCACTTTTGCATCCACAATTAAGGAAGAAGTCAAGTAAATCAATAGAAACCAAATGCTACAAAGCAC
          TGCCATATACAACTGCAACGGATTGCATTAGGAGAACTAACAATTGAGTAGCTCAACATTTATAGCAAAAACAATACGAA
          ATCTAGAATAATATAGCAACTACTATACAAAATCGGAGACCACGAACAAATGAGGGAGAAAAGGCAAAAAGGAACATCAA
          CAGCGGAATAAAGTTATGAAAATTGGATGAATGAAGCATGAAGCAAGCCCAGAAACGAGAAAAAAGTTGTGGTATAAACT
          TTTATTGTAGGAAAACGCATAAAAATAATAGAAAAACGCTCTTCGGGTTGTAAAGAAAATAAGAAGACAAAAGAAAGACA
          TGAAAACGTTGCGAACAATAAAGCATATACTTGCCATATTGATATAAAGGGAAATCGTGAAAAGGCGGTGAAAATTTCGT
          AAGATTAGTTGGTATTAAGGGCAGCCCAGGCACACAGCTAAAAAGGGAACTAAAAAAACCCCGCACAGAACAATGAAAGC
          TGCAGCAGCTGGATAAGGCCGACAAAACCGAAAATTATATTATTGTAATCTAGTAGAGAGCAGACAACATATCCGCTGGC
          AACAACCAACACCGAAAGAGACTATGAAAAATGCACAACTGAAACTGACTGAAGTTGACGATGATGAGCTGTGGCTGGCA
          GTAAGATTAGCGCACTGCAGCAGCAACATCAGCAGCAGTAGCAGCACAAGAACCACCAGCAGCAACAAGAGGCACAACCA
          GCAACTCACAACACTGCAACCAAGGAGCTTAAGTACAAAACACCACAGCAACATTGCAAGCGAGCAGCACAATAGCCAGC
          AACAGGAGCCAGCATCGAAGGACGAGGATGTAGCCAACCACGGTAGAAGCAATGACCAGCAGACGCATCTGCAACAGCTA
          GACAGCAGCAACATGTTGTCGCCAAAGACAGCCGCAGCAGCAACTGCTGCCGGCGATGAAGCAACAACCCAACAACCAAC
          AAACATAAGACTGTGTGCACGCAAGCGACAACGATTGCGTCGCCGACGAAAAAGAAAACCAGCAACCCCAAACGAAACAG
          ATATCAAGAAACAACAGCAACTTAGCATGCCTCCCTTCAAAACGCGCAAATCCACGGACACCTACAGCACACCAGCAGCA
          ATAACCAGCTGTCCGACAGCCACCTACATGCAATGTCGAGCCAGCGACAATGAGTTCAGTATTCCGATATCGAGACATGA
          TAGAGTATCCACGGCCACATTCGCCTGGGTGTTGCATGTGCTGCAGGTGCTGCTCGTGTCGCTGCAACAGTGGCAACTTC
          ACGTGCAACAGCGATCGGTGCTACTGTTCAGAAGGATCGCAGCGAGCACCATCGCCTTCATTTCCTATTTAGGCAGCTTT
          GCAGCGCAACTGAGGAGCAGCAGCAGTAGCAGCAGCAACAGCAGCAACAGCGGCAACAGCAGCAGCACGCAAATATTAAA
          CGGACTTAATAAACACTCATGGATATTTTTATTGATATATTTGAATTTATCTGCTAAAGTTTGCCTAGCAGGATATCATG
          AAAAGAGACTGTTACACGATCTTTTGGATCCCTATAATACACTAGAACGTCCCGTTCTCAATGAATCGGACCCGTTACAA
          TTAAGCTTTGGTTTAACTTTAATGCAAATTATCGATGTGGACGAGAAAAATCAATTGCTAGTCACTAATGTGTGGTTAAA
          ACTGGAGTGGAACGACATGAATCTCCGCTGGAACACCTCCGACTATGGCGGAGTTAAGGATCTGCGAATACCGCCGCATC
          GCATCTGGAAGCCGGACGTGCTGATGTACAACAGTGCGGATGAGGGATTTGATGGCACCTACCAGACGAACGTGGTGGTG
          CGGAACAACGGCTCGTGTCTATACGTTCCGCCGGGGATCTTCAAGTCGACGTGCAAGATCGACATCACGTGGTTCCCCTT
          CGATGACCAGCGGTGCGAGATGAAGTTCGGCAGTTGGACCTACGACGGATTCCAGCTGGATTTACAATTACAAGATGAAA
          CTGGCGGTGATATCAGCAGTTACGTGCTCAACGGCGAGTGGGAACTACTGGGTGTGCCCGGCAAACGTAACGAAATCTAT
          TACAACTGCTGCCCGGAACCCTATATAGACATCACCTTCGCCATCATCATCCGCCGACGAACACTGTACTATTTCTTCAA
          CCTGATCATACCTTGTGTACTGATTGCCTCCATGGCCTTGCTCGGATTCACTCTGCCGCCAGATTCGGGTGAAAAATTAT
          CACTGGGTGTTACCATCTTGCTCTCGCTGACCGTGTTTCTGAATATGGTTGCCGAGACAATGCCGGCTACTTCCGATGCG
          GTGCCATTGCTGGGTACATATTTCAATTGCATAATGTTTATGGTAGCTTCATCCGTTGTGTCAACGATTTTAATATTAAA
          TTATCATCATCGAAATGCTGATACGCACGAAATGTCCGAATGGATACGCATCGTGTTTTTGTGCTGGCTGCCATGGATAT
          TGCGAATGAGTCGACCAGGACGACCGCTGATCCTGGAGTTCCCGACCACGCCCTGTTCGGACACATCCTCCGAGCGGAAG
          CACCAGATACTCTCCGACGTTGAGCTGAAAGAGCGCTCGTCGAAATCGCTGCTGGCCAACGTACTAGACATCGATGATGA
          CTTCCGGCACAATTGTCGCCCCATGACGCCCGGCGGAACACTGCCACACAACCCGGCTTTCTATCGCACGGTTTATGGAC
          AAGGCGACGATGGCAGCATTGGGCCAATTGGCAGCACCCGAATGCCGGATGCGGTCACCCATCATACGTGCATCAAATCA
          TCAACTGAATATGAATTAGGTTTAATCTTAAAGGAAATTCGCTTTATAACTGATCAGCTACGTAAAGATGACGAGTGCAA
          TGACATTGCCAATGATTGGAAATTTGCAGCTATGGTCGTTGACAGACTGTGCCTTATCATATTCACAATGTTCACAATAT
          TAGCCACAATAGCTGTACTACTATCAGCACCACATATTATTGTCTCGTAGCCATATGGGCGAGGTGGTTATTGTTATTGG
          TTTTATTATAAAATCAATTTGTTAATTATTAAATTAATAACGAAACTCTTTAAGTAAATTAAAACTAAAAAGACACTAAA
          AAAGCACAAAAAAATAGGAAAATACATGATAAAAACCATCAACTAAATAATACATCCAAGAAAAACCAAAACAAAAAAAA
          CAAAAAAAAAAAAACAATTAAAAATCGTCTCTGAAAACACAATAATTTAATTATAAACTTCTCGTTTAAAAGTCTTTCAT
          TCAAATCAAACAGACACTAAACAAATAAGAGACTAAACCAACATCATATACTAAAACGTTAAAAATTAACTAATTCCAAT
          TTTCCTAATTCTATACAAAAATCTATATAATGGTAAACCAAAGAAATCCCCTCACTTCCCGCAAGCCCCCACAAGCCAGT
          ATCTAGATTTCTTCCATTGAATATATATATATATATATACATACTATACATGTTTGAACAGCAAGCAAAACGGGTATATT
          TTCTTTTTAGATATGTTATATTTTATAGGATAAGCGAGGCGTTTTCATACAAATAGTTACATGGGTTTTCGAAACTTTTT
          TTTTTGACAGACTTCAATGGAAAGTGCAGTTTTTCAATGCAGAACGAACAAAAGCCTCCCCCAAACCTTTTAGGAAAACT
          TCAATTTGTGAGCTTTATACTCGTAGTAGGAAACGTAGGTGGAAAATTTGCGACTCGTTTACGATATGAAAACCCAACGC
          ATTGAGATCTACAAAAGGAAAAACCAAATTTGTATCTTCTTCTTCAGCATTGAAGTCCAGTCCAGAGATTTGTTCCGAGC
          AACTTTTTGCTAGCAATTAGTACCTAGGCCAACTAAGTGATTACGCCACATTCCCCCCTCTAAACGAAACTGCATTTCCG
          AAACAGAACCAATTAACCCTACATATCCAGTACTGTGTGTCTAGTGCCCCCTCCCTCGTCTTAATTTAAACTGAATGTCT
          AAACCAATCGAAAAATAAATCGAAAACCAAATCCCTAAGCGTAAAAACCAAACCCCGTAAACCCTACCAAAACCAATAGA
          ATAACCAATCTGAATTGGAATTAAGAAAATTTACTGGAATATAAAAGATAAAATGAAAAATCAAAACGATGCGAATGAAA
          ATGGGCGAACATGTGAGTAATTGACGAGCGGCACAGCAGATGAAGATGAGCCCAGAATGGCGCTCAGTAAATGAAATGCA
          TCCGACGGATTGCATTTCATGTTGACTGGCGCTGCACAGGAAATGAATTTATAAATTAAATGGTTGCGAGCAATAATATC
          TGCGTGTTGATGAATTGCATGATTTTTGGTGATGCAAACGATGATCGATCGAACTATTGTGCGAGGTCCACGACAAAAGG
          GCAAGAGTTCGCTCCTTCAGCGCATTGAGAACAGCGAACCTCTGTATTGATCTCACGATATTTTCATTTTCATTTACATT
          TTCGTTTGAACTTTCACTCTTCTGTTTTGAACAAATACTCAAAGTTGAGGCACCAGAAAGCAATTCAACACACAAACCGA
          ACTTAACTCGATAGAAAATCAGAGGCCAGACAGACCAACAACAAGTAGCGCATTCGAGATATACATATGTATTTACCAAT
          AACAATGAACATCACAGATCCCAGAACACATAACATGCCGGTGCATGGGTAATTATGTGCTTGCTCTGGTATTGAGCGCA
          CAAAACATACTGATACCAGACCACAACAACCAAAACATATAAACCAAGGAGCTTTATACAGATATATGTATGATATATAT
          ATGACGGAGTTAGCGTGGGTCCATCTGACCCGACTTTTCATATATTTGTACCACACACAAAAACCACACAGGACACACAA
          ACGGTTGTTCGATGGCCAGCTTATGCCAATTTGTATGTTTCTGTCCGCCAACTAGCCAAGCACACAATTTCATGATGACA
          AGACAAGGAATACAAGAAACAAAATCTTAAAAATTACCATGGTCTGGCGGATCTCTCGGGAAGTGCGTAGGATCAGCTGG
          GGAAGGTCCTGGCATACTGCGCATTTCCTGATCGAAAGGATCCCGTGACCGAGCATAGAAGAAAAAGCAAAGCTGCGTTG
          GTCGAAAATTCACACTGACTTTTCTTTCCACACAAAAGCGAAGAAAACGTTCGAAATGGAATTAGCTTTTTAATTTTTAA
          GTTACAGTTATTCTGCTTCTAATTGTAAATCTTGTGCAATGTAAACAATCAGAATTTTTCTTTGAATATAAAACAATACG
          AACACACCGAAACCAAGAGCAAACAAACGCGTATCGGTCACAGTGAAAATGCAAAATGAAAACATATAAGATTTCAAAAA
          TAAATAATGGAAATATGATTAGCAACTAAACGATGTCATTCAATTTAGACTAGGCTACACACAAAAACCATAAATTGTTA
          AGACTCTATCCAAAGAGCTAAGAAACGCGAACTCAAACAAAACATACTAGAAATAGATATTTACAAGCAACAATAAGTAT
          AATTCGAATATCGAACAGAACGAAGAAATAGTTAAGCATATATGAATATCGAGCAAATTGGTTTTTATGCGATTCGGTTA
          GAGGAAATTTTCAAACATCACTTTGTATGCAGATTTTGTATGCCCAACTATACAGATTTCTGATCCGCTCTTTTTTTTTT
          TTTGCTTGATTTAACTTTAAATGATTGATCGAAATTTACAGATAAGGTTTAGCTTTTGATAAAAAAAAGATTGCAAATGT
          AAAATAATATGAGAACTTGGTATATTTTGATGAAAGGTGAAATTATTTGTACATTTTGTTGTATGCCCACGGGATTAGCT
          GGAAACGGTTGATATTTGTGGGGGACTTTCTTAATGTTTTTGATAAACATGTATTTTATTTTATATGCTTTTCCAATGCG
          ATTGTCAGTGAGAACGATTAACGATAGATTTCAATCCTAACGCTTAAGAGTATTAATGAAATAATAATAGAGAACATAGC
          AAACAAGCTGCCAGCATGAAAAATAAAAACAATAACTAATTTTAAATCTTTTATACATTTCCATCAAATGTGCTTATTTA
          AACACAAGAGAATGCAAACCAAAATGCCCAACTGAAATATCTGATGGCCGTTTTCAAATAGCAATCAATAACTGGATTAT
          GTTCAACATCCAATTAGCTGAAGTTGAACAAATGTTTTCATATAAGCAATTTTTAAAGAAAAACGTCACCCCGGTAAATA
          AATACATAGGAAATAGTAAGGCAATCTGGGCTGACTGACTAATCGTCAAAATTAGTCGAGGCCATCGAATGGAGCAGAAT
          GACGGAGATTAAAACTAATAAAGTTCTAGAGCATAATGAGGACAGTTTGGAAAATAGTTCTTGATCAACCATTAATACAC
          AGTTTATACATATATGTGTATATTTACATGGATATATATGTATGTGCGTACGTATATACTTCTTTTTACACAGAC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0080594
          4396
          FBtr0300594
          9129
          FBtr0309867
          7755
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0423154
          837
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0089367
          808
          FBpp0289821
          808
          FBpp0301601
          808
          Comments

          Stop-codon suppression (UAG) postulated; reflected in aa sequence of predicted polypeptide.

          translation_exception: stop_codon_readthrough

          Extended 3' UTR based on RNA-Seq and/or EST data.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          nAChRα5-RI
          Secondary FlyBase IDs
            References (0)