Open Close
General Information
Symbol
Dmel\CG46385-RF
Species
D. melanogaster
Annotation Symbol
CG46385-RF
FlyBase ID
FBtr0474229
Feature type
Associated gene
Evidence Rank
Length (nt)
4996
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 82 )
Sequence
AGTCGTTCAACGAGAGTGACCGCGTGCGAAAGCCAGAATCAAGACAACGCACATCCTCTGTACTCATATAGAAACTGCAT
TATTTAATTCAAATAAGACAGCTGACGACTGAAAGAACCAGACCAGATCAGACCAAATTACCTAGAGAAGCTAGAGAAGC
CAAGCCATCGTCTTGCTAAGCAGAATTCAATCGGCTCCTTATACTAAACACATAGTATAAGCACCGACCGACCGACCGAC
CTGCCGAGAGGTGTCCATCGAAAAGTCTAGAAAGAGCGAAGGAAATTCCGAAAGCGCCAGCGGAAAAATCGAGGGAACAT
TCTGGCAACAGGACTGTTGCTTCGCCACCACCATCCACCCACTCAACTGCGCCCACATCGAGTGGCAGAGCCAACATATG
TTCGCCTGGCTACACCCAAGCTGAACTGTCTTTGGACCATATGTTGTTAACGTTGTTGTAACGTTGTTGTTTCGTGTGTG
AACCAAATAACATACATATATATATATATATATAACCATAGCCATAGCCATAGCCATAGCCAAACAAGAGAAATTTCCCG
AGTGCGCGTGTGTCTAGTGTGTCTAAAACATAGCAAGAAAAAAAAAAAGAAAAAGAGTAAGCAAGAAGAAAAATCAAGCA
AAAAAAAAGTAGCAAAAAGTGCAATTGAAAACGAAAACGAGGGGAAGAGCCAAACTAATTGCCAGCAGCAGCACAGCAGC
CAACTCTCGCTAAAACCAGAACCATCTGGAGTGCTGTTATATTTTCGCCCATATATCCTGTCGCTCGTCGCATCCAGCAT
TCTTATGAAACCGGAAAATCGGCATGAGTCGTACAATGCAAAGTGCGGGACACTAGACGGAGCCGAACCGTTGTATCATC
AACAGCGCAGCAACAGAATGGACGTCTACCAGATCGACGATGGATTCCACTCGGACGGCGGCACCGAGACTCCGCCGCCG
TCACCCAGTTCTGGGTCATCGATCGCCTCGACCTCGGACCACGGATCGCTGGAGAGCGTGGACACTGGGGGGACGCAGCG
GCTGGCCGTGCTATCGTTCGAGCAGGTGAGCAAACTGCACGACGTCATGGACGAGAAGGTGGCCATCCATGGGCGCGGCA
ATTTTCCCACACTGGAGGTGAAGCTCAAGGATCTGGTCAACCTGGTGCGCCGCAAGCTGGAGGCGGAGGTGAACGCCGGC
GGCGCCGGGGTGTTAGTTAAGGACATCCGTCTCAATGGCGGGGCAGCTAGTCATGTTTTAGCCAGCGAGGATCAGCCGTA
CAATGACCTGGACCTGATATTCGCCATCGAGCTGAGTTCGCCACGCGTCTTTGACCGCGTCAAGGTGGCGGTGCTCAACA
CCCTGCTGGACTTGATGCCCGAGGGCGTCTGCAAGCGACGCATCTACACGTGCTCCCTGAAGGAGGCCTACGTGGGCAAG
ATGGTCAAGGTGAACAACAACAATGACGGCGATCGCTGGTCCCTCATTTCGCTGGGCAACTCGCCGGGCCACAAGAACGT
CGAGCTGAAGTTCGTGGACACGATGAGGCGCCAGTTCGAGTTCTCGGTGGACTCGTTCCAGATTGTGCTGGACTCGCTGC
TGCTCTTCTACGACTGCGCCGCTCTGCCCATCTCGGAGAACTTCTATCCAACGGTGGTCGGCGAATCGGTCTACGGGGAC
TTCCAGGAGGCACTCTACCATTTGCAAAAGAAACTGATCTCAACGCGTCAGCCGGAGGAGATACGAGGCGGCGGCCTGCT
CAAGTACTGCAATCTATTGGTGCGTAACTACAAGGCCGTCGACTCGCAGCTCATCAAGACCCTGGAGCGCTACATGTGCT
CGCGCTTCTTCATCGATTTCCCGGACATCAATACGCAGACCACCAAGCTGGAGGCCTACTTGCGTAACCATTTCTGGGGC
GTCGATGAGGAACCGCTGCAGTATCAGTACCTGATGCATTTACGCGAGGTAGTCGAGATGTCGACGGTCTGTCTAATGGG
CCACGAGCGGCGCCAATCGCTCCATCTAATCCAGTCGCTGGCCGCTCAGGTGCTCTTCAACAAGCAGGAGAAGCAGCAGC
AGCAGCAGGCCCAGGAGAAGTACCAGCAGCAACAGCAGCAGCAGCAGCATCAGCAAAATCAGCAGCAGCAGCAGCAGCAG
CGTCAGCATCAGTTCCTTGACCCAGCGCAGCAGCAACAGCAGCAGCAGCAGACACAGACGCAACAGCAGCAGGCGCAGCA
GGCAACTACCCTGACCCTTGTCCCGCAGGCGCCGCCCACGGGCCAGGCGCAGACCATTTATGTGCAACAGGCCGCCCCAG
CCGCCGTGTGCTGCACGAGCAGCGCGGATCAGACGGCGACAGCGGCACCACAGACCATACAGATACAGGCCGGTCCGCCG
GGACTCATCTATGCCAACGGCGTCTACTATGCACCTGTGATCCCCAGCACCATCTGCACGTGCAACTCCACCTGGCTGAG
CACGTGATTAGAACGGCAGGAGCAGGAGAAGGAGCAACAGCACCACCAGCACGAGCAGCAACAGTTCCAACAGCAACAGT
GGTCAGAGGATGCATTGGGAGCGACACTTTTGGCTGAAACTGAAACTGAACCACCACTAGCAACAGCATCGATAGCGCCA
CCACCACCATCATCTCAACCACCATCATCACCGTCAACAACAGCACCCAGAACCCAAGTCCAAAACCAGACCAGATCCAC
GACCATCAATAGCAGCAACAGGAAGAAGAAGAACAAGGCCAAGACTCAGAGTAAGCAACAGACGCAGACAGCAACAGAAG
CAGAAAGCAATTGCAACGAGAAGCCGACCACAGCAACCATGACAAGGACAACAACAAAGAAGAGCAGCAGGATCAAGCAA
ATGGCAGCAGCAGCAGCAGCAACGGAAGCATGTGCAGCAAAGGGAGGAGCCGGCGGAATCACGGGCAGCTTGGTGCTGAC
ACCTCAGCAGATCAACGGACTGCCCGTTTACAACCAACTGGATGATGGCGGACGATCGGCGGCGGGCACGTACAGCGGAC
AGTTTGCCTACTTCTATCCGCACGACGGCTCGGCGCCCAGTATGTTTCTGCTGGGCGAGGACTCCTACCTCAATGTTACC
GAACAACAGGAGCAGCACCAGCACCAGCATCAGCACCATAATCACCAGTTTGTCTAGGATGTGGAGAAGAAGATGTGGGA
AACGGTTCATGCTTGCTGGCCTGGCCGTGCCACTTGGCACTTTACGATTACTGTTGATTCATCATTACTCATATATTCGG
TTGGCTACTTTCTTCGTTAACTGTATGATCAGAGGTCTATTTCACTGTTCCTTTTCTATATCTCTAATTGAATGTGTCCG
GCGACTTGAAAGCCTTTCCACGACACTTGGCACACACGCGCTCCTACTTTAATAATGTAACTATCCCGAGAGTTTGAACC
GCAGACTGAACTTCAGCCGCTGTTAGATGTTGAACAGGGACACCACCTAAATCACTGACACACAAAAAGGACGAAAACGA
TTGCGTATCACATCACTAGTTTGGCTATATGAAAATCCTTTTACACCATATGCACAACATTTACGTTATTTGTGTAACTT
TCTTTGCCTACGAAAACTAAATTTTACTTTGTAAAACCTATTGAAAGTCTAAAAAAAAGAAAACAAAAAATATACAAAAA
AAAGTAACCTGATAATTTAAAGCCAAAATTTAATCTGTTTGCTCGGTCGAAAGTCGTTTTCATCTTTTCCAACATTTATC
TTTTTTGTAATAAACCTACCCAAACACTCAAAGCTGTAATGTAATTTTGGATTTGCCAACCACCCACATGTCCCCGCACA
CCTATCATTGTATTTTTTAATAAACAAACAGACACACACAAAACCTAAAAAAAAAAACAAAAATGTGAAAAAATACGGCA
TGCATATGTAGCACGTTAATTTCGAATTGACCTTTTTGTATGCCAAGTGCAACAGACGAAGGCGGCGTTTTGGGTTCCAG
TCTAGAAATTCCAAGCAACAATCTAATTGCAGGCTGAAATGATAATTTAAAGCGATGATATGTAAATATTAGTCAAATTA
ATATGTGGACGAGGATTCGGAAGTGTAGAGGATTTATATATATATATATATATATGTGTCTGGTGTACCAGAAGTTGCTC
AATGAAATTCAATCCACAAAGCAAAGTTAAACCGAAATAAATTTTAAAGTAATGTGTAGAACGAAATGTCATATTTTGTA
GAATATTTTCGGTGTGTCCTGACAACAGCAACATATTATGTTATGTAGGTATGTGAATGATTGATTGAGTGTATTGTTAA
AACCAGCTGGTGATAATTAATGAATGATATAGACATGATATAGATATGCTCTAGACAACAAATATTAATAGTTCGAAACG
AAACACTTCACTTCGTCGAAAACCATCAAGGAATGTTAGATTAATGTGTAATTCTCTGTTTTTGCAATTGCAACAAAATA
CCACAAGCAACTAAGGAATATATACTTATATGCAACCATAAATATATATACACATATATGTTTATATCCACAACAAATGA
AAGACAAATGGTCCACAGAGCAAAATGAGTCGAAGATGAGTGGATGTGGATGTGGATGACGATGGATGATGATTAGCTTA
CGATGTTTCCTCTCCGTGTGCATTCTTTGATAACTTTGAGAATTGTCTACCAACTACACACTTTTGTATAATGTTAACCT
TGAACTTGTGTTTTGAATTTATGTATTAACTTTAGTTTAAACATTGTGACATAATGTACGATGTATGTACATACTGTATG
TACATACTGTATACTGTATGTATGTGTATATATCCAGATTATCTATATGCATATTCGACAAGGTCCAAAGCCAACGTATT
CCAATTTGCGATCTGCAAAACATTTTACTTAGTGCAAACTTTAAAACGAGTTAACCTGATACTGAAACTGAAACCGAAAC
CGAACTCTAACTGAATCAAAATCTAAACCAAAAATT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0474224
5129
FBtr0474225
4996
FBtr0474226
5320
FBtr0474227
2978
FBtr0474228
5129
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0423182
790
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0423177
877
FBpp0423178
560
FBpp0423179
529
FBpp0423180
529
FBpp0423181
1107
Comments

Stop-codon suppression (UGA) postulated; reflected in aa sequence of predicted polypeptide.

translation_exception: stop_codon_readthrough

Transcriptional initiation site supported by short-capped RNA data (FBrf0209722).

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
CG46385-RF
Secondary FlyBase IDs
    References (0)