Open Close
General Information
Symbol
Dmel\CG46025-RE
Species
D. melanogaster
Annotation Symbol
CG46025-RE
FlyBase ID
FBtr0475046
Feature type
Associated gene
Evidence Rank
Length (nt)
1604
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 9 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          ATGCCAATGATGAAGATCAATGTAGAGGACGACTTTCTCATCGACTTTGTGCAATGCACTCTGGAGCCGGAGGAGAGTTT
          CAATTTACCGCGCATTAGCGCCCGCCTGGAGCGTCTGATGGGCACCAATGTGGTCAAGCTAACGGACCGGAGCTACATGA
          AGGAGCTGCGGGAACGAATTGACGAGGATTACCGCAAACAGCTGCTGTCCCGCATTCGCGCCCGGGAGTTAAAAGAAGTG
          GAGCGCGAACGAATGCTGATTATCGAGGGCAAGTCAGACGTAATACCAGACGAACTAGCCAACGATCCCATATTCATGGT
          TAACAAAGATGCCAACATGGAGATTCAAAAGGAGCGCTCCAAGCTGAAGACCGCTCGCGAGAAGAACGCGGAGCGTTTGA
          AGCTGCAGGGCGTTAAATGGGAGCGGGAAAGGCTTCAACATGCCGCCAAGGAAGCCGAACTGCTGGCCAAGAAACGCGAG
          CGGCACCGCCAACAGAAATTACTGGTGGAGCAGTACAGGACCGAGGATGCGGAGAGGGGAATGGATCTGCTGCGCATCGA
          TAACGAAGACTGGCGGGAGTGCGAAAAGAGCCTGAAGGAGTTCCTCGAACAGGAGCGTGCCAAAATGAAGGAGCGTTCGT
          TGCGCATATCCCAGCCCTACTCCTCGGATCCCCAGGATATACAGAATATAGTCAGGGCCAGGCAAAAGTTCCGGGAGACC
          GAGCTGCGTATTCGCAATCAGCTGGAGGACAAGCTAAAGGATGTCAAACTTGCGGTCACCACTCAACAACTAACCGAACT
          TATCGAGGATGCCCATCGTTCCAGCGGGGAGATCATTATGCCACAAGAACCTTCGATGGAGGACGATGACTTCCAGGGCG
          GCGCAGTGAACTCTAAATATCTGGACGATGCCACCGATGTCTCCGAGGAGACGGTGATCAGCGAGGATGCCATCAGCCTG
          ACGCTGGCCAAGCAGCAGTACGCCGAGGAACTGGAGGCCGAAATGGAGGACGAGTTCAATCGAGGTCTGCTCATCTCCAA
          GCAGCAGTACGATCAGCTGCGCTTCGAGGATGAGAAGATCGTGGCGCTCAGAAATGCCAAGGATATTCGCGAGCTGTATC
          AACTGGCCGAGGAGATCATCATGGGTGAGAACTACGTCGAGGCACCGGAGGAGTGCGAGGAGGAGGCGGTGGTGGAGGAG
          CCGGAACAAGATATCTCCTCCGATCACGAGGCCCAGGAGCCAGCCAAAGCCTAATGAGAAGCTATAGAATAAAACCATTT
          TTTACGTTCGGTGGACAGCGGCTGGTCGTTTATCCTGCTGCACCAGTTTTTAGCGAGTTCTACAATATTTGGCAAAATAT
          TTGGTTTCCCATCCATGAGAGTCCAGATATTTCACCAAATCGTGCAAACATCAATTAGGCTGGGGTACCTACCACAGTTT
          GTTAGACGTCGGAAGAGGTAGCGCAATCGAAAAACGTTAGCTAAACTGTCACTCAATCTCAGCGTTTAGGTTGATAACTT
          GATAACTGTCAATGGGGTTTAATTAAAGCTGTAACGACTTGATTGTACCCGCATGACAACAAAAATAAAGCGGCCGAAAA
          ATCC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0347188
          1837
          FBtr0347189
          1083
          FBtr0347187
          2036
          FBtr0347190
          2435
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0423260
          417
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0312499
          441
          FBpp0312500
          209
          FBpp0312498
          441
          FBpp0312501
          596
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG46025-RE
          Secondary FlyBase IDs
            References (0)