Open Close
General Information
Symbol
Dmel\tim-RU
Species
D. melanogaster
Annotation Symbol
CG3234-RU
FlyBase ID
FBtr0480508
Feature type
Associated gene
Evidence Rank
Length (nt)
5931
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 39 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        GCATTCAGCATTGTGCGTTCCAAATATAAAACAAAAATAATTTCATCAGTGTATATAACAGCACTGAAACTATAACACGA
        TCTATTCTGCAAAGAAACCCAAAAAGTGCTCAGAAAAGCTCAATTGCTTAGAAACATAAACAATCAGCTTTAATTGTTGA
        TTGCAATTCGGCTAAAACTAAAACAGTAAAATTGTCTGCGATAGAAAAAATTTAAATAATTGTTACAGATACCGCGCAAA
        TGGCTAAGAAGTACCTCAATGTTCGCAGTCGACAATGAGCAGAGTTAGGCAGCTCCACAATCACATCTGGAATAATCAGA
        ACTTTGATAAAGTGAAATCGGTTATGGACTGGTTACTAGCAACTCCGCAGTTGTACAGCGCGTTCTCCTCCTTGGGTTGC
        TTGGAGGGCGATACCTATGTGGTCAACCCGAATGCATTGGCCATTCTGGAGGAGATCAACTACAAGCTCACCTATGAGGA
        CCAAACACTGCGCACCTTTCGACGGGCCATTGGATTTGGCCAGAATGTGAGGTCAGACCTGATACCGCTGCTGGAGAATG
        CCAAGGATGATGCGGTCCTGGAGTCGGTCATCCGGATACTCGTCAATCTGACGGTGCCGGTGGAGTGCCTCTTCTCCGTG
        GACGTGATGTACCGCACGGATGTGGGTCGCCACACCATCTTCGAGCTGAACAAGCTGCTGTACACCAGCAAGGAAGCATT
        TACCGAGGCCAGGAGCACCAAGAGCGTGGTGGAGTACATGAAACACATACTGGAGTCGGACCCTAAGCTGTCGCCGCACA
        AATGCGATCAAATCAACAACTGTCTGCTGCTGCTGAGAAATATCCTGCACATTCCAGAGACGCATGCCCATTGCGTGATG
        CCCATGATGCAGTCGATGCCGCATGGCATCTCCATGCAGAACACGATCTTGTGGAATCTCTTCATCCAGAGCATCGACAA
        GTTACTCCTGTATCTGATGACCTGTCCGCAGAGAGCCTTCTGGGGAGTGACCATGGTGCAACTGATTGCTTTGATCTACA
        AGGATCAGCATGTGAGCACTCTGCAAAAACTACTTAGCCTCTGGTTCGAAGCCTCTCTGTCGGAGAGCTCTGAGGATAAT
        GAGAGTAATACCTCGCCCCCCAAACAGGGCAGTGGCGATTCCAGCCCCATGCTGACCTCTGATCCTACCTCTGATTCCTC
        GGACAATGGCAGCAATGGCCGTGGCATGGGCGGTGGCATGCGGGAAGGAACAGCGGCCACTTTGCAGGAGGTGAGCCGCA
        AGGGTCAGGAGTATCAGAACGCCATGGCCAGAGTGCCAGCGGATAAGCCCGATGGCTCCGAAGAGGCCAGCGATATGACG
        GGGAACGACAGCGAGCAGCCTGGATCGCCGGAGCAATCGCAGCCCGCCGGCGAGTCCATGGACGATGGAGATTACGAGGA
        CCAGAGACACAGGCAACTGAACGAGCATGGCGAGGAGGATGAAGATGAGGACGAAGTGGAGGAGGAAGAGTACCTACAAT
        TGGGCCCAGCCTCGGAGCCCCTAAACTTAACACAACAACCAGCTGACAAGGTCAACAACACTACCAACCCAACGTCCAGT
        GCGCCACAAGGCTGCCTGGGCAATGAGCCATTCAAGCCACCACCTCCTCTGCCAGTCAGAGCCTCCACCTCGGCACACGC
        TCAAATGCAGAAGTTCAACGAATCGTCCTACGCGTCCCACGTATCTGCGGTCAAATTGGGCCAAAAGTCCCCACATGCCG
        GCCAGCTCCAGCTGACCAAGGGCAAGTGTTGCCCACAGAAGCGGGAATGCCCCTCCTCGCAGTCGGAGCTATCGGATTGC
        GGTTATGGCACCCAGGTGGAAAATCAGGAATCCATTTCCACCTCCAGCAACGACGATGATGGGCCGCAGGGCAAGCCGCA
        GCACCAGAAGCCTCCGTGTAACACGAAGCCACGGAATAAACCACGGACGATTATGTCGCCAATGGACAAAAAGGAGCTTA
        GACGCAAAAAACTGGTCAAGCGCAGCAAAAGCAGCCTCATCAACATGAAGGGTCTGGTACAGCACACCCCCACCGATGAT
        GACATCTCCAATCTGCTGAAGGAATTCACCGTGGATTTCCTCCTCAAGGGTTACAGCTATCTGGTGGAGGAACTGCACAT
        GCAACTGCTTTCCAATGCGAAGGTGCCCATTGACACATCGCACTTCTTCTGGCTGGTCACCTACTTCCTGAAGTTTGCCG
        CCCAACTGGAGCTGGATATGGAGCACATCGACACTATTCTCACCTACGATGTTTTGAGCTACTTGACCTATGAGGGTGTG
        TCCCTATGTGAGCAACTGGAACTGAATGCCCGACAGGAGGGCAGTGACCTGAAGCCCTATCTAAGGCGAATGCACTTGGT
        GGTGACGGCCATCCGGGAGTTCCTCCAGGCCATTGATACGTACAACAAAGTGACTCATCTGAACGAGGACGACAAAGCCC
        ATTTGAGGCAGCTTCAGCTGCAGATTAGCGAAATGTCCGATCTGAGGTGCCTTTTTGTGCTTCTGCTGAGGCGTTTCAAT
        CCCAGCATTCATTCCAAGCAGTATCTTCAGGATCTGGTGGTTACCAATCACATCCTCCTACTCATTCTGGACAGTTCGGC
        CAAACTTGGTGGATGTCAAACCATTCGCCTGTCGGAGCACATAACACAGTTTGCCACGCTGGAGGTGATGCACTACTATG
        GCATTCTGTTGGAGGACTTCAACAACAACGGAGAGTTTGTCAATGACTGCATCTTCACCATGATGCATCACATCGGTGGC
        GATCTGGGCCAGATTGGGGTTCTATTTCAACCAATTATTTTGAAAACCTATTCAAGAATTTGGGAAGCGGACTATGAACT
        GTGCGATGACTGGTCTGATCTTATCGAGTATGTGATTCACAAGTTCATGAATACTCCTCCGAAGTCGCCACTCACCATTC
        CTACAACTTCCTTGACGGAAATGACCAAGGAACACAACCAGGAGCATACCGTTTGCTCTTGGTCGCAGGAGGAAATGGAC
        ACACTTTATTGGTATTATGTGCAGAGCAAGAAGAACAACGATATTGTGGGAAAGATAGTTAAGCTCTTCAGCAACAACGG
        CAACAAGCTGAAAACCAGGATTTCTATTATCCAACAACTTTTGCAACAAGACATTATCACCCTGTTGGAATACGATGACC
        TGATGAAGTTCGAGGATGCGGAGTATCAGAGAACTTTGCTGACAACTCCCACTTCCGCAACAACAGAGTCTGGAATTGAG
        ATTAAGGAGTGCGCCTACGGCAAACCCTCAGATGATGTTCAGATCCTGCTGGACCTGATCATTAAGGAAAACAAGGCGCA
        GCATTTGTTATGGCTGCAAAGGATCCTCATTGAGTGCTGCTTCGTTAAACTGACCCTGCGGAGTGGTCTCAAGGTTCCGG
        AAGGCGATCACATCATGGAGCCGGTGGCCTACCACTGCATCTGCAAGCAGAAGTCCATTCCGGTGGTGCAGTGGAACAAC
        GAGCAATCCACTACGATGCTGTACCAGCCTTTTGTTCTCCTGCTCCACAAGCTGGGCATTCAGCTGCCGGCGGACGCGGG
        CTCGATCTTCGCCAGAATTCCGGACTACTGGACACCGGAGACAATGTACGGACTCGCCAAAAAGCTGGGACCGCTGGACA
        AACTCAACCTCAAGTTCGACGCCAGTGAACTGGAGGATGCGACGGCGTCGAGTCCGTCGCGTTACCACCACACCGGACCC
        CGCAACTCGCTCAGCTCGGTAAGCAGCCTGGACGTGGATCTCGGCGATACCGAGGAGCTGGCCCTTATACCCGAGGTGGA
        TGCGGCCGTGGAGAAGGCACACGCCATGGCATCCACGCCATCGCCCAGCGAGATTTTCGCGGTTCCCAAGACGAAGCACT
        GCAACTCGATCATCAGATACACACCAGATCCCACGCCTCCAGTGCCCAACTGGCTGCAGTTGGTCATGCGCAGCAAATGC
        AATCATCGCACAGGTCCGTCTGGTGATCCCAGCGATTGCATTGGCTCCTCGTCGACAACCGTGGACGATGAGGGATTTGG
        CAAGTCCATCAGTGCAGCCACTTCGCAGGCGGCGAGCACCTCCATGAGCACGGTTAATCCCACAACCACTTTGAGCCTGA
        ACATGCTAAACACCTTCATGGGAAGCCACAACGAGAACAGCAGCAGTTCTGGTTGCGGGGGCACCGTCTCCTCCCTGTCC
        ATGGTGGCTCTGATGAGCACCGGCGCGGCAGGCGGAGGAGGTAACACCTCCGGGCTGGAAATGGATGTGGACGCCTCCAT
        GAAGTCCTCGTTCGAGCGGCTGGAGGTAAACGGATCGCACTTCTCGCGGGCCAACAACTTGGACCAGGAGTACAGTGCCA
        TGGTGGCATCTGTGTACGAAAAGGAGAAGGAATTAAAGTGAGTGCGATTGAGCCTGGTGTCCCAGCTCAATGGATGCCTA
        TTTAACGAGTCGCACATAGGTTACATTTATTTGTTTAAAAAAAAAATATTTTTATAACGTTATTTTAAACATGTCACCTC
        TCAGTTTGACAGATTTCTTCCATGCAATATTTTCTCAGTCGCCTCACATGGCCTTTTTCTAAAATATTTTCAATGCTTTT
        TGTGATAATTTGAAAATATTGTTTGAACAGATTTCTTGAATAGATAGTTCCCCTCTTACGTACATACTTAGAAATATGTA
        TTCCAGATCTCCCCTTTACCAAATACTTATTATAAACCTAATTAATTGTTCGGCATATCTCGGCCAGTCGGTTGGCACAC
        AGCTTAGAAGCATATTTTAAGATACATAATTGTTATATATTAAGGATGGTGAAATGTGGCACTATCCAAACCATTTCATT
        CGTTTATTTTGTGACCCAAACCCCTTTACCATTGAGTTAACTCAGATATATATTGGCTTTCAACGAAAGATAAAAAAGAA
        AATCGAAACCGATGGAGGCGAGGCTCTAGTCAATCCCCAGCCAAGATTTCGACCTGGCTAATTGACAATTAGACAGATTG
        CGCAAATGGCAGCCCGTCATTCTGTCAATATGTCGACCAAGGAGGGGAAAAGCTGGAGAATGCCGGGCATTGCTGAACAG
        TGTCTCACATAAATTTATGGCAAGCAATTATTCAATTTCAGCCATTTGCGGCTGGCAAACGTTTTCCAGTTCGTATGCGC
        GATTTCAATGGCTCTTTTTTGGCCACCAAATTGTTCTTGGCCTTTTTTTTTGTGTGTGTGCTCATGTTTCGTCTTTTGGC
        TCATGATCATTGCAGCAGCGACAATGTCTCTTTGGCCTCGGACCTGACCAGAATGTATGTGAGCGATGAGGACGATCGAC
        TTGAGCGAACCGAGATCCGGGTGCCCCACTATCACTGAGGATCCAATTCCAATCGATCCTAACCGATCCGATCCGATATC
        CGAGTTTTGAGTGAGGCCCACCCAGCTGGAAAGAATTGTACCTTAATCAATCAAATCAAGTAACGTTTAATATCACCCGG
        CACAAGGATTGTACATTTTATGACCTCTAAATGCAAAAGTATACCTGATTAATTAGCTACGCATAACGTAAATTACGCGG
        ATAAACAAAAAAAGTCCAAGCAGAAAGTGAAGAAAAGTGCATTATTTGGTTAATGAATGTGAGGCTCTGCAGACTGTTTG
        CCTATGCTAGCCCACTAGATACTCTTAAGTTAACCTTAGTTTCCAATCGTATTCGGTATACCTACCTACCACATACACAC
        ACATACATGTAAATGGGCAGTTCCTGGTTCAAATAGTGCAAATATACACACATAAATCTATTTACACGTTTAAGAAAGAA
        GAGCGACCGGTGTCCATCCACCAAAAACCATCTGTATGTATATCCTTAGTCATAAGTTATGCTTAGCAGTAATAAAGCTT
        TCCCTGTAGCC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0077567
        5073
        FBtr0333252
        5077
        FBtr0333253
        5641
        FBtr0333254
        3136
        FBtr0333255
        3525
        FBtr0333256
        5404
        FBtr0333258
        5020
        FBtr0333259
        5214
        FBtr0445397
        5073
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0428305
        1365
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0077256
        1398
        FBpp0305450
        1397
        FBpp0305451
        1131
        FBpp0305452
        890
        FBpp0305453
        891
        FBpp0305454
        1398
        FBpp0305456
        1366
        FBpp0305457
        1099
        FBpp0401565
        1421
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        Corresponds to tim-cold (FBrf0244295, FBrf0244296).

        Downstream translation start supported by FBrf0092669 and FBrf0101975, and by comparative analysis across Drosophila species.

        External Crossreferences and Linkouts ( 0 )
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        tim-RU
        Secondary FlyBase IDs
          References (0)