Open Close
General Information
D. melanogaster
FlyBase ID
Feature type
Also Known As
Computed Breakpoints include
Sequence coordinates
Member of large scale dataset(s)
Nature of Aberration
Cytological Order
Class of aberration (relative to wild type)
Class of aberration (relative to progenitor)
Carries alleles
Transposon Insertions
Formalized genetic data
Genetic mapping information
Comments on Cytology
Sequence Crossreferences
DNA sequence
Protein sequence
Gene Deletion and Duplication Data
Genes Deleted / Disrupted
Complementation Data
Partially deleted / disrupted
Molecular Data
Completely deleted
Partially deleted
Genes NOT Deleted / Disrupted
Complementation Data
Molecular Data
Genes Duplicated
Complementation Data
Completely duplicated
Partially duplicated
Molecular Data
Completely duplicated
Partially duplicated
Genes NOT Duplicated
Complementation Data
Molecular Data
Affected Genes Inferred by Location
    Phenotypic Data
    In combination with other aberrations

    Inferred to overlap with: Df(2R)ED1.

    Lethal in combination with Df(2R)ED1.

    Lethal in combination with Df(2R)ED1. Lethal in combination with In(2LR)DTD99.

    NOT in combination with other aberrations
    Stocks (2)
    Notes on Origin
    Balancer / Genotype Variants of the Aberration
    Separable Components
    Other Comments

    Deletion extending from the 3' end of the P{lacW}GstS1k08805 insertion to a site within the coding sequence of the Ark gene. The P{lacW} element sequence is adjacent to the sequence GGTTTAGCAATTATTACTTTATTT within the Ark gene. The 5' and 3' ends of the P{lacW} element are present and non-rearranged (determined by DNA sequencing) and the w+mC marker within the element is still present (as judged by phenotype).

    Synonyms and Secondary IDs (6)
    Reported As
    Symbol Synonym
    Name Synonyms
    Secondary FlyBase IDs
      References (14)