Open Close
General Information
Symbol
Dmel\ci57
Species
D. melanogaster
Name
FlyBase ID
FBal0001646
Feature type
allele
Associated gene
Associated Insertion(s)
Carried in Construct
Also Known As
ci57g
Key Links
Allele class
Mutagen
Nature of the Allele
Allele class
Mutations Mapped to the Genome
 
Type
Location
Additional Notes
References
Inserted_sequence:

AATTTATTTATTAACTGAATAAATTATTT

Comment:

Deletion of 646bp and an insertion of 29bp (AATTTATTTATTAACTGAATAAATTATTT) at the same site.

Associated Sequence Data
DNA sequence
Protein sequence
 
 
Progenitor genotype
Cytology
Nature of the lesion
Statement
Reference

Deletion of 646bp and an insertion of 29bp at the same site within the 2.2dis element, located 2.5kb upstream from the start of transcription.

Small deletion in the PstI HaeIII fragment that removes or alters the PstI site, results in deletion of a transcriptional silencer element.

800 bp deletion ci1, ci36, ci57, ciD and ciW mutant in the same 5.8 kb Bgl fragment. This fragment hybridizes to a 2.0 kb RNA that shows peak concentrations in late pupae.

Expression Data
Reporter Expression
Additional Information
Statement
Reference
 
Marker for
Reflects expression of
Reporter construct used in assay
Human Disease Associations
Disease Ontology (DO) Annotations
Models Based on Experimental Evidence ( 0 )
Disease
Evidence
References
Modifiers Based on Experimental Evidence ( 0 )
Disease
Interaction
References
Comments on Models/Modifiers Based on Experimental Evidence ( 0 )
 
Disease-implicated variant(s)
 
Phenotypic Data
Phenotypic Class
Phenotype Manifest In
Detailed Description
Statement
Reference

Does not affect embryonic development but causes an adult phenotype, vein defects in the posterior compartment of the wing.

Coordinate mutant.

Wing vein interruption. Homozygous viable.

External Data
Interactions
Show genetic interaction network for Enhancers & Suppressors
Phenotypic Class
Phenotype Manifest In
Enhanced by
Statement
Reference

ci57 has phenotype, enhanceable by en1

ci57 has phenotype, enhanceable by en4

ci57 has phenotype, enhanceable by en59

ci57 has wing phenotype, enhanceable by enEnci

NOT suppressed by
Statement
Reference

ci57 has phenotype, non-suppressible by su(Hw)2

Additional Comments
Genetic Interactions
Statement
Reference

Wing phenotype is enhanced by enEnci at 18oC.

Xenogenetic Interactions
Statement
Reference
Complementation and Rescue Data
Images (0)
Mutant
Wild-type
Stocks (3)
Notes on Origin
Discoverer

Hochman, July 1957.

Comments
Comments

Strength of ci alleles showing a ci phenotype in combination with enEnci can be ordered: ci1 < ci36 < ci57 << ciW.

External Crossreferences and Linkouts ( 0 )
Synonyms and Secondary IDs (2)
References (11)