Deletion of approximately 1.4kb that extends from 136bp upstream of the bam coding sequence to 1282bp within the coding sequence. The sequence CATGATGAAATAACATGTTATTATGTTATGTTATGTTATTTCATCATGTTATTTCATCATGTTAA is present at the site of the deletion.
Deletion of most of the coding sequence.
Near complete deletion of the bam coding sequence.
Coding region except the carboxy-most 6 residues deleted.
A 1418bp deletion in bam, extending from 136bp upstream of the coding sequence to 1,282 bp within the coding sequence. The sequence CATGATGAAATAACATGTTATTATGTTATGTTATGTTATTTCATCATGTTATTTCATCATGTTAA is present at the site of the deletion."
CATGATGAAATAACATGTTATTATGTTATGTTATGTTATTTCATCATGTTATTTCATCATGTTAA
female sterile (with bamΔ59)
male sterile (with bamBG)
neoplasia | adult stage | female (with bamΔ59)
cystoblast | increased number (with bamz3-2884)
egg chamber (with bamz3-2884)
germarium | heat sensitive, with bamhs.PO
ovariole (with bamz3-2884)
ovary (with bamz3-2884)
spermatogonium | increased number (with bam1)
bamΔ86 mutants form tumors in the germaria that accumulate undifferentiated germline stem cell-like cells.
Clones of bamΔ86 mutant female germline stem cells fail to properly differentiate, causing the accumulation of spectrosome-containing cells throughout the germarium.
Expression of bamhs.PO induced via heat shock in a bamΔ86/bamΔ86 background results in increased germline stem cell differentiation, as evidenced by a lack of germline stem cells 24 h after heat shock, and germaria exhibiting only fusome-containing cysts within the niche, and very few spectrosome-containing cells; however at 48 h after heat shock, a majority of germaria show some single spectrosome-containing cells.
Heterozygous bamΔ86 testes show a ~60% 'tumor' rate.
Homozygous germline clones in the ovary result in stem cell-like tumours in the anterior region of the germarium. In contrast to wild type, the tumorous cells do not show a decrease in nucleolar size as the distance from the stem cell niche increases.
In bamz3-2884/bamΔ86 mutant ovaries, the germaria and most of the egg chambers are filled with undifferentiated cystoblasts.
bamΔ86/+ germaria have an increased number of spectrosome-containing cells compared to wild type.
Approximately 27% of bamΔ86/+ spermatocyte cysts contain 32 cells with 2% containing 64 cells.
75% of fusomes are spherical in bamΔ86 ovaries, and the remaining 25% are short and cylindrical.
bam1/bamΔ86 mutant testes show large germline cysts containing 32 or more cells undergoing S-phase, some located far from the testis tip, indicating that more than the usual 4 rounds of transit amplification has occurred.
bamΔ86/+ males usually make the transition from mitotic proliferation to spermatocyte differentiation, but often this occurs late. 43% of germline cysts complete at least one extra round of transit amplification prior to differentiation.
40% of male germline cysts prematurely differentiate at the 8-cell stage in males carrying one copy of bamΔPEST in a bamΔ86/+ background. In these cases, the 8-cell cysts have large cells with typical spermatocyte morphology. Post-meiotic cysts are observed with 32 instead of 64 elongating spermatids.
Each bamz3-2884/bamΔ86 transheterozygous ovariole has a tumorous germarium with 0 or 1 normal egg chambers, in contrast to wild type ovarioles that have 7-10 egg chambers after the germarium.
In bamz3-2884/bamΔ86 ovarioles, the tumorous germaria and egg chambers contain many single germline stem cells.
bamz3-2884 ovarioles carry a tumourous germarium and no normal egg chambers.
bamΔ86/+ germaria show a signifiant increase in cystoblast number compared to controls.
Mutant germaria are tumorous, containing only undifferentiated germline stem cell-like single germ cells.
bamΔ86 germline stem cell (GSC) clones outcompete normal, wild type GSCs and occupy their niches within germaria; in addition, mutant cystoblasts can invade the niche occupied by wild type GSCs and assume GSC identity. This appears to happen by the mutant GSCs simply forcing out the neighbouring wild type GSCs, as neither apoptosis nor differentiation is induced.
bamΔ86 germline stem cells (GSCs) divide significantly faster than controls.
In bamΔ86 homozygous females, there is a substantial increase in the numbers of both escort stems cells and escort cells per germarium.
In bamΔ86 female mutants, the ovariole tip contains a "stem cell tumour", comprising hundreds of germline stem cells (GSCs). This is in sharp contrast to wild-type ovarioles, which contain only 2-3 GSCs. As with wild-type GSCs, bamΔ86 GSCs delay cytokinesis. However, bamΔ86 GSCs lack the associated cap cells seen in wild type. Additionally, the new fusome of bamΔ86 GSCs grows to the same size as the old fusome and does not stretch out into the "exclamation point" configuration characteristic of GSCs in contact with cap cells.
Mutant females have tumorous ovarioles containing 300-1000 undifferentiated germ cells.
bamΔ86 female germ cells fail to differentiate.
bamΔ86 homozygous females have ovaries with 'stem cell tumors' consisting of large numbers of undifferentiated germ cells.
Homozygous germ line clones in the testis overproliferate as spermatogonia-like cells.
bamz3-2884/bamΔ86 females are weakly fertile with small ovaries containing mostly wild-type egg chambers. Many germaria lack morphologically distinct cysts. Egg chambers containing endoreduplicating nurse cells and having a monolayer of follicle cells surrounding each egg chamber are seen.
Homozygous ovarioles show a tumourous phenotype. No elongated spermatids are present in homozygous testes.
Fate and proliferation of somatic cyst and hub cells is not affected in mutants testes. Mutant testes are not sexually transformed. Mutant clones induced in the cysts of male testes produce cysts with many more than 16 small germ cells, each having the morphological features of amplifying germ cells. Germ cells accumulating in the testes have a mixed identity, simultaneously retaining some aspects of stem cell fate while expressing markers of amplifying spermatogonial and primary spermatogonial cell fates. Distribution of both fusome and ring canal components indicates many mutant germ cells within a cyst are interconnected as a result of incomplete cytokinesis during the divisions leading to overproliferation. Most germ cells within a cyst undergo S and M phases in near-synchrony.
Homozygous females in which bamhs.PO is expressed using heat shock begin to lay eggs within 7 days of heat shock. Some of these eggs hatch and produce viable, fertile adults. Rescued ovaries are smaller than wild-type and contain a mixture of normal and abnormal egg chambers. The females do not produce tumorous cysts once heat shocks are stopped.
Nearly every cell in an adult ovary contains a fusome, most often the organelles are spherical and sometimes appeared as two spheres that are close enough to touch. These look like a dumbbell and are suspected to be a fusome that has passed through a ring canal to connect two cells. Whenever a ring canal connects cells a fusome fills the canals lumen. bamΔ86; hts1 ovaries are phenotypically indistinguishable from bamΔ86 ovaries.
bamΔ86 has increased cell number | oogenesis | germline clone phenotype, enhanceable by wtsx1/wtsx1
bamΔ86 has increased cell number | dominant phenotype, enhanceable by tut4
bamΔ86 has abnormal cell cycle phenotype, enhanceable by Scer\GAL4nanos.PG/howL.UAS
bamz3-2884/bamΔ86 has female sterile phenotype, enhanceable by bgcn[+]/bgcn1
bamΔ86 has increased cell number | germline clone | oogenesis phenotype, suppressible by Dcr-1Q1147X/Dcr-1Q1147X
bamΔ86, wtsx1 has increased cell number | germline clone | oogenesis phenotype, suppressible by Dcr-1Q1147X/Dcr-1Q1147X
bamΔ86/bamBG has male sterile phenotype, suppressible by Dsim\bambam.Venus
bamΔ86/bamΔ59 has female sterile phenotype, suppressible | partially by Dsim\bambam.Venus
bamΔ86 has neoplasia | female | germline clone phenotype, suppressible by ball2
bamΔ86 has abnormal cell cycle phenotype, suppressible by howstru-3R-3
bamz3-2884/bamΔ86 has female sterile phenotype, suppressible by eIF-4a[+]/eIF4A1006
bamz3-2884/bamΔ86 has female sterile phenotype, suppressible by eIF-4a[+]/eIF4A1013
bamz3-2884/bamΔ86 has female sterile phenotype, suppressible by eIF-4a[+]/eIF4Ak01501
bamz3-2884/bamΔ86 has female sterile phenotype, suppressible by eIF-4a[+]/eIF4A02439
bamΔ86 has hyperplasia phenotype, suppressible by zpgunspecified/zpgunspecified
bamΔ86 has increased occurrence of cell division | germline clone | spermatogenesis phenotype, non-suppressible by put135
bam[+]/bamΔ86 is an enhancer of increased size | oogenesis phenotype of Ras85DV12.cZa.UASp, Scer\GAL4VP16.nanos.UTR
bam[+]/bamΔ86 is an enhancer of increased cell number | adult stage | female | temperature conditional phenotype of Crei\I-CreIhs.PR
bam[+]/bamΔ86 is an enhancer of male semi-fertile phenotype of CHES-1-likeUAS.Tag:HA, Scer\GAL4VP16.bam
bam[+]/bamΔ86 is an enhancer of hyperplasia | adult stage | male phenotype of CHES-1-likeUAS.Tag:HA, Scer\GAL4VP16.bam
bam[+]/bamΔ86 is an enhancer of hyperplasia | adult stage | male phenotype of CHES-1-likeUAS.Tag:HA, Scer\GAL4VP16.nanos.UTR
bam[+]/bamΔ86 is an enhancer of increased cell number | recessive phenotype of tut4
bam[+]/bamΔ86 is an enhancer of increased cell number phenotype of Scer\GAL4VP16.bam, stgUAS.cNa
bam[+]/bamΔ86 is a suppressor of decreased cell number phenotype of Scer\GAL4VP16.bam, trblUASp.cMa
bamΔ86 is a non-suppressor of decreased cell number | oogenesis phenotype of pelo1
Dcr-1HMS00141, Scer\GAL4VP16.nanos.UTR, bamΔ86/bamBG has decreased cell number | oogenesis phenotype
Dcr-1Q1147X, bamΔ86 has abnormal cell cycle | oogenesis phenotype
Ras85DV12.cZa.UASp, Scer\GAL4VP16.nanos.UTR, bamΔ86/bamBG has abnormal cell number | oogenesis phenotype
Ras85DV12.cZa.UASp, Scer\GAL4VP16.nanos.UTR, bamΔ86/bamBG has decreased cell size | oogenesis phenotype
Ras85DV12.cZa.UASp, Scer\GAL4VP16.nanos.UTR, bamΔ86/bamBG has increased size | oogenesis phenotype
CG6015HMS01037, Scer\GAL4bam.PU, bamΔ86 has increased cell number | spermatogenesis phenotype
CG6015HMS01037, Scer\GAL4bam.PU, bamΔ86 has increased occurrence of cell division | spermatogenesis phenotype
Dsor1HMS00145, Scer\GAL4bam.PU, bamΔ86 has increased occurrence of cell division | spermatogenesis phenotype
Scer\GAL4C587, bamΔ86, bamhs.PO, dppJF01371 has decreased cell number | heat sensitive phenotype
Scer\GAL4C587, bamΔ86, bamhs.PO, ptcJF03223 has decreased cell number | heat sensitive phenotype
bamΔ86, mei-P261 has male sterile phenotype
bam[+]/bamΔ86, mei-P261 has female semi-sterile phenotype
bamΔ86 has female germline cell | increased number | germline clone phenotype, enhanceable by wtsx1/wtsx1
bamz3-2884/bamΔ86 has cystoblast | increased number phenotype, enhanceable by CSN5N/CSN5[+]
bamz3-2884/bamΔ86 has cystoblast | increased number phenotype, enhanceable by Nedd8[+]/Nedd8AN015
bamΔ86 has spermatocyte cyst phenotype, enhanceable by Scer\GAL4nanos.PG/howL.UAS
bamΔ86 has spermatocyte phenotype, enhanceable by Scer\GAL4nanos.PG/howL.UAS
bamΔ86 has cystoblast | increased number phenotype, enhanceable by eIF4AUASp.Tag:MYC/Scer\GAL4VP16.nanos.UTR
bamz3-2884/bamΔ86 has phenotype, enhanceable by bgcn[+]/bgcn1
Dsim\bambam.Venus, bamΔ86/bamΔ59 has ovary phenotype, non-enhanceable by bgcn[+]/bgcn1
bamΔ86 has germline cyst | germline clone phenotype, non-enhanceable by Mad12
bamΔ86 has female germline cell | increased number | germline clone phenotype, suppressible by Dcr-1Q1147X/Dcr-1Q1147X
bamΔ86, wtsx1 has female germline cell | increased number | germline clone phenotype, suppressible by Dcr-1Q1147X/Dcr-1Q1147X
bamz3-2884/bamΔ86 has cystoblast | increased number phenotype, suppressible by CSN4[+]/CSN4N
bamz3-2884/bamΔ86 has cystoblast | increased number phenotype, suppressible by CSN4k08018/CSN4[+]
bamΔ86 has female germline cell phenotype, suppressible by udd1
bamΔ86 has spermatocyte cyst phenotype, suppressible by howstru-3R-3
bamΔ86 has spermatocyte phenotype, suppressible by howstru-3R-3
bamz3-2884/bamΔ86 has ovariole phenotype, suppressible by eIF-4a[+]/eIF4A1006
bamz3-2884/bamΔ86 has ovariole phenotype, suppressible by eIF-4a[+]/eIF4A1013
bamz3-2884/bamΔ86 has ovariole phenotype, suppressible by eIF-4a[+]/eIF4Ak01501
bamz3-2884/bamΔ86 has ovariole phenotype, suppressible by eIF-4a[+]/eIF4A02439
bamz3-2884/bamΔ86 has germarium phenotype, suppressible by eIF-4a[+]/eIF4A1006
bamz3-2884/bamΔ86 has germarium phenotype, suppressible by eIF-4a[+]/eIF4A1013
bamz3-2884/bamΔ86 has germarium phenotype, suppressible by eIF-4a[+]/eIF4Ak01501
bamz3-2884/bamΔ86 has germarium phenotype, suppressible by eIF-4a[+]/eIF4A02439
bamz3-2884/bamΔ86 has female germline stem cell | increased number phenotype, suppressible by eIF-4a[+]/eIF4A1006
bamz3-2884/bamΔ86 has female germline stem cell | increased number phenotype, suppressible by eIF-4a[+]/eIF4A1013
bamz3-2884/bamΔ86 has female germline stem cell | increased number phenotype, suppressible by eIF-4a[+]/eIF4Ak01501
bamz3-2884/bamΔ86 has female germline stem cell | increased number phenotype, suppressible by eIF-4a[+]/eIF4A02439
bamz3-2884/bamΔ86 has ovariole phenotype, suppressible by vas[+]/vasRJ36
bamz3-2884/bamΔ86 has ovariole phenotype, suppressible by eIF4E1S058911/eIF-4E[+]
bamΔ86 has female germline stem cell | germline clone phenotype, suppressible by E2f107172
bamΔ86 has female germline stem cell | germline clone phenotype, suppressible by E2f1rM729
bamΔ86 has female germline stem cell phenotype, suppressible by pelo1
bamΔ86 has female germline stem cell phenotype, suppressible by zpgunspecified/zpgunspecified
bamΔ86 has female germline stem cell | increased number | somatic clone phenotype, non-suppressible by lili2
bamΔ86 has female germline stem cell | increased number | somatic clone phenotype, non-suppressible by lili3
bamΔ86 has germarium phenotype, non-suppressible by eIF-4a[+]/eIF4Ak01501
bamΔ86 has germarium phenotype, non-suppressible by eIF-4a[+]/eIF4A02439
bamΔ86 has ovariole phenotype, non-suppressible by eIF-4a[+]/eIF4Ak01501
bamΔ86 has ovariole phenotype, non-suppressible by eIF-4a[+]/eIF4A02439
bamΔ86 has female germline stem cell | germline clone phenotype, non-suppressible by put10460
bamΔ86 has female germline stem cell | germline clone phenotype, non-suppressible by put135
bamΔ86 has female germline stem cell phenotype, non-suppressible by pelo[+]/pelo1
bamΔ86 has germline cyst | germline clone phenotype, non-suppressible by Mad12
bamΔ86 has spermatogonium | increased number | germline clone phenotype, non-suppressible by put135
bamΔ86 has testis | germline clone phenotype, non-suppressible by put135
bam[+]/bamΔ86 is an enhancer of spectrosome | oogenesis phenotype of Ras85DV12.cZa.UASp, Scer\GAL4VP16.nanos.UTR
bam[+]/bamΔ86 is an enhancer of germarium phenotype of Ras85DV12.cZa.UASp, Scer\GAL4VP16.nanos.UTR
bamΔ86 is an enhancer of male germline cell phenotype of CG6015HMS01037, Scer\GAL4bam.PU
bamΔ86 is an enhancer of male germline cell phenotype of Dsor1HMS00145, Scer\GAL4bam.PU
bamΔ86 is an enhancer of testis phenotype of DhpsHMS02169, Scer\GAL4bam.PU
bamΔ86 is an enhancer of male fusome phenotype of DhpsHMS02169, Scer\GAL4bam.PU
bamΔ86 is an enhancer of testis phenotype of Scer\GAL4bam.PU, cncHMS00650
bamΔ86 is an enhancer of testis phenotype of Scer\GAL4bam.PU, cncHMS02021
bam[+]/bamΔ86 is an enhancer of cystoblast | adult stage | increased number | temperature conditional phenotype of Crei\I-CreIhs.PR
bam[+]/bamΔ86 is an enhancer of testis | adult stage phenotype of CHES-1-likeUAS.Tag:HA, Scer\GAL4VP16.bam
bam[+]/bamΔ86 is an enhancer of testis | adult stage phenotype of CHES-1-likeUAS.Tag:HA, Scer\GAL4VP16.nanos.UTR
bam[+]/bamΔ86 is an enhancer of spermatid phenotype of CHES-1-likeUAS.Tag:HA, Scer\GAL4VP16.nanos.UTR
bam[+]/bamΔ86 is an enhancer of spermatogonium phenotype of tut4
bam[+]/bamΔ86 is an enhancer of spermatogonial cyst phenotype of Scer\GAL4VP16.bam, stgUAS.cNa
bam[+]/bamΔ86 is a suppressor of egg chamber phenotype of aurB1689
bam[+]/bamΔ86 is a suppressor of germline cell phenotype of aurB1689
bam[+]/bamΔ86 is a suppressor of ring canal phenotype of aurB1689
bam[+]/bamΔ86 is a suppressor of nurse cell phenotype of aurB1689
bam[+]/bamΔ86 is a suppressor of female germline cyst phenotype of aurB1689
bam[+]/bamΔ86 is a suppressor of female fusome phenotype of aurB1689
bam[+]/bamΔ86 is a suppressor of spermatogonial cyst phenotype of Scer\GAL4VP16.bam, trblUASp.cMa
bamΔ86 is a suppressor of phenotype of CycAΔ.Tag:HA
Dcr-1HMS00141, Scer\GAL4VP16.nanos.UTR, bamΔ86/bamBG has female germline cell | absent phenotype
Dcr-1Q1147X, bamΔ86 has female germline cell | germline clone phenotype
Ras85DV12.cZa.UASp, Scer\GAL4VP16.nanos.UTR, bamΔ86/bamBG has ovary phenotype
Ras85DV12.cZa.UASp, Scer\GAL4VP16.nanos.UTR, bamΔ86/bamBG has female germline cell phenotype
CG6015HMS01037, Scer\GAL4bam.PU, bamΔ86 has spermatid phenotype
CG6015HMS01037, Scer\GAL4bam.PU, bamΔ86 has male germline cell phenotype
CG6015HMS01037, Scer\GAL4bam.PU, bamΔ86 has male fusome phenotype
CG6015HMS01037, Scer\GAL4bam.PU, bamΔ86 has cyst cell of testis | increased number phenotype
Dsor1HMS00145, Scer\GAL4bam.PU, bamΔ86 has male germline cell phenotype
Dsor1HMS00145, Scer\GAL4bam.PU, bamΔ86 has male fusome phenotype
CHES-1-likeUAS.Tag:HA, Scer\GAL4VP16.bam, bam[+]/bamΔ86 has spermatid phenotype
Dsim\bambam.Venus, bamΔ86/bamΔ59 has ovary phenotype
Dsim\bambam.Venus, bamΔ86/bamΔ59 has female germline stem cell phenotype
Scer\GAL4C587, bamΔ86, bamhs.PO, dppJF01371 has germarium | heat sensitive phenotype
Scer\GAL4C587, bamΔ86, bamhs.PO, ptcJF03223 has germarium | heat sensitive phenotype
ball2, bamΔ86 has female germline stem cell | germline clone phenotype
CSN4UASp.Tag:HA, Scer\GAL4nanos.PU, bam[+]/bamΔ86 has cystoblast | increased number phenotype
CSN5N/CSN5[+], bamΔ86 has cystoblast | increased number phenotype
bam[+]/bamΔ86, nanosALL.Tag:MYC has germarium phenotype
bamΔ86, pum9/pum02003 has germline cell | female phenotype
bamz3-2884/bamΔ86, bgcn[+]/bgcn1 has germline cell phenotype
bamz3-2884/bamΔ86, bgcn1 has germline cell phenotype
bam[+]/bamΔ86, mei-P261 has egg chamber phenotype
bamΔ86, mei-P261 has egg chamber phenotype
bamΔ86, bgcnQS2 has germline cell phenotype
The reduced male fertility as well as morphological defects in the adult testes (including but not limited to hyperplastic cyst overgrowth) observed in adult males expressing CHES-1-likeScer\UAS.T:Ivir\HA1 under the control of either the Scer\GAL4nos.UTR.T:Hsim\VP16 or the Scer\GAL4bam.T:Hsim\VP16 driver are enhanced to a variable degree by combination with a single copy of bamΔ86.
Expression of dppJF01371 or ptcJF03223, but not ciGD1403, under the control of Scer\GAL4C587 in flies expressing bamhs.PO induced via heat shock in a bamΔ86/bamΔ86 background suppresses the recovery of spectrosome-containing cells at 48 h after heat shock seen in flies expressing bamhs.PO alone in a bamΔ86/bamΔ86 background.
ball2 bamΔ86 double mutant germline cells in the ovary do not form tumours. The double mutant cells are lost from the stem cell niche, with the rate of stem cell loss being similar to that seen in ball2 single mutants. Double mutant germline cells that have been displaced from the niche do not differentiate into germline cysts and they eventually degenerate.
One copy of CSN4N dramatically suppresses the increase in the number of undifferentiated cystoblasts seen in bamz3-2884/bamΔ86 mutants, dramatically increasing the number of differentiated cysts containing a branched fusome and the number of normal egg chambers per ovariole.
One copy of CSN4k08018 dramatically suppresses the increase in the number of undifferentiated cystoblasts seen in bamz3-2884/bamΔ86 mutants, dramatically increasing the number of differentiated cysts containing a branched fusome and the number of normal egg chambers per ovariole.
Expression of CSN4Scer\UAS.P\T.T:Ivir\HA1 under the control of Scer\GAL4nos.PU in a bamΔ86/+ mutant background results in an increase in cystoblast and two cell cyst number in the ovary compared to controls. Germline stem cell number is unaffected.
One copy of CSN5N drastically and significantly enhances the differentiation defect of the bamΔ86/+ mutants. The number of cystoblasts and two cell pairs is significantly increased compared to either heterozygote alone.
One copy of CSN5N drastically enhances the differentiation defects seen in bamz3-2884/bamΔ86 mutant cystoblasts.
One copy of Nedd8AN015 drastically enhances the differentiation defects seen in bamz3-2884/bamΔ86 mutant cystoblasts.
The germarium phenotype of bamΔ86 Df(3R)Exel6198/twin41 bamΔ86 double mutant females is a mixture of a bam mutant phenotype (accumulation of germline stem cell (GSC)-like cells containing a spectrosome) and a twin mutant phenotype (lack of GSCs or lack of germ cells). The phenotype changes over time, with the percentage of bam mutant phenotype decreasing and the percentage of twin mutant phenotype increasing as the flies age. The double mutant GSCs are able to differentiate.
3 day old females expressing nosALL.T:Hsap\MYC in a bamΔ86/+ background show a modest but consistent increase in the average number of spectrosome-containing cells per germarium which is accompanied by a statistically significant loss of differentiated cysts. This effect is more pronounced in 20 day old females.
Expression of howL.Scer\UAS under the control of the weak driver Scer\GAL4nos.PG enhances the bamΔ86/+ phenotype, as shown by the fact that 65% of cysts containing 32 spermatocytes, compared to 27% in bamΔ86/+ single mutants.
A howstru-3R-3 heterozygous background results in the generation of 8-cell cysts of spermatocytes and suppresses the extra divisions present in bamΔ86/+ males.
The delayed differentiation of 16-cell male germline cysts until they are greater than 32-cells/cyst in animals expressing stgScer\UAS.cNa under the control of Scer\GAL4bam.T:Hsim\VP16 is enhanced from 11% to 27% in a bamΔ86/+ mutant background.
The premature differentiation of 8-cell male germline cysts observed in animals expressing trblScer\UAS.P\T.cMa under the control of Scer\GAL4bam.T:Hsim\VP16 is suppressed, from 63% to 10%, in a bamΔ86/+ mutant background, and the frequency of 16-cell cysts is increased from 37% to 87%.
Most bamz3-2884/bamΔ86; eIF-4a/+ ovarioles contain 4-6 normal egg chambers, while the germaria contain fewer single germ cells compared to bamz3-2884/bamΔ86 ovarioles.
All of the eIF-4a alleles tested fail to dominantly suppress the tumourous phenotype of bamΔ86 ovarioles.
The vasRJ36 or eIF-4ES058911 allele dominantly suppresses the bamz3-2884/bamΔ86 ovariole phenotype.
Scer\GAL4nos.UTR.T:Hsim\VP16-driven expression of eIF-4aScer\UAS.P\T.T:Hsap\MYC in a bamΔ86/+ background results in significantly more cystoblasts in the germarium compared to bamΔ86/+.
bamΔ86 E2f107172 double mutant germline stem cell (GSC) clones are much less competitive than bamΔ86 single mutant GSCs.
bamΔ86 E2f1rM729 double mutant germline stem cell (GSC) clones are much less competitive than bamΔ86 single mutant GSCs.
bamΔ86 put10460 double mutant germline stem cell (GSC) clones retain a similar ability to bamΔ86 single mutant GSCs to outcompete wild type GSCs in the same niches.
bamΔ86 put135 double mutant germline stem cell (GSC) clones retain a similar ability to bamΔ86 single mutant GSCs to outcompete wild type GSCs in the same niches.
pum02003 bamΔ86/pum9 bamΔ86 double mutant ovaries have a complex phenotype that is distinct from that of either single mutant. A mixture of apparently undifferentiated cells and overtly polyploid cells is seen. In many cases, the polyploid chromosomes are thick and expanded like nurse cell chromosomes. Occasionally these pseudo-nurse cells are organised within an epithelial layer of follicle cells, like a cyst, although these cysts never contain a full complement of 16 cystocytes. These cysts contain ring canals.
piwi1 ; bamΔ86 double mutant ovarioles have mildly tumorous germaria filled with 50-300 undifferentiated germ cells with no apparent egg chamber development. fs(1)Yb72 ; bamΔ86 double mutant ovaries display the same phenotype as seen in bamΔ86 single mutants. Most germaria are devoid of germ cells in pum1 bamΔ86/pum9 bamΔ86 double mutant females.
In pelo1;bamΔ86 double mutant germaria, germ cells are able to differentiate as cystocytes can form. This is evidenced by branched fusomes, although the morphology of these fusomes is abnormal. However, some germ cells remain undifferentiated, as abnormally enlarged spectrosomes persist. Germ cell differentiation is not rescued when bamΔ86 homozygous mutants are pelo1/+; these germaria also show the rapid loss of GSCs observed in pelo1 germaria.
The 'stem cell tumor' phenotype seen in the ovaries of bamΔ86 homozygous females is suppressed by zpgunspecified/zpgunspecified.
bamΔ86 ovarian tumor cells transplanted into the dorsal mesoderm of stage 11-12 embryos from oskunspecified mothers can repopulate the ovaries of the resulting adults, forming tumorous ovaries. The fertility of these flies can be rescued by heat shock if the transplanted cells carry bamhs.PO.
bamΔ86 can dominantly suppress the 32 cell cyst phenotype seen in heatshocked CycAΔ.T:Ivir\HA1 flies, reducing the proportion seen five-fold.
bgcn1/+ ; bamz3-2884/bamΔ86 females show germ cell hyperplasia. None of the germ cells contain the polyploid DNA complement that is diagnostic of nurse cell formation. These females are sterile.
mei-P261/Y ; bamΔ86/+ males are completely sterile. Spermatid differentiation fails to progress in these males. mei-P261/mei-P261 ; bamΔ86/+ females show a severe decrease in fertility compared to mei-P261/mei-P261 females, due to an increase in the formation of ovarian tumours and other egg chamber defects. Recombination is also severely decreased in these females. mei-P261/+ ; bamΔ86/+ females have normal fertility.
bgcnQS2; bamΔ86 double mutant germ cells also are interconnected and undergo S phase in synchrony. The double mutant germ cells, just like germ cells in either single mutant behave as amplifying primary or secondary spermatogonial cells, and not as stem cells, indicating that bam and bgcn are not partially redundant with each other.
Crei\I-CreIhs.PR germaria in which DNA damage has been evoked by heat-shock accumulate cystoblast-like single cells and this accumulation is strongly enhanced by bamΔ86 heterozygosity.
Expression of Dsim\bambam.T:Avic\GFP-YFP.Venus restores fertility of the otherwise sterile bamBG/bamΔ86 males (even under sperm exhaustion conditions).
Expression of Dsim\bambam.T:Avic\GFP-YFP.Venus partially restores fertility of the otherwise sterile bamΔ59/bamΔ86 females. The ovaries of the rescue females show multiple morphological defects that accumulate with age (loss of germline stem cells, improper number of cyst divisions, mitotic synchrony defects). However, when two copies of the Dsim\bambam.T:Avic\GFP-YFP.Venus transgene are used, the fertility of the rescue females is reduced (compared to one copy rescue) and they become virtually sterile by day 15. They also show accelerated loss of the germline stem cells from the ovaries and often lack them or any germline cells altogether. These effects are alleviated even by a single copy of endogenous wild-type bam. The partial fertility of bamΔ59/bamΔ86;Dsim\bambam.T:Avic\GFP-YFP.Venus xenogenetic rescue flies is also improved by Wolbachia pipientis infection.
The ovarian defects observed in bamΔ59/bamΔ86;Dsim\bambam.T:Avic\GFP-YFP.Venus xenogenetic rescue females cannot be exacerbated by combination with a single copy of bgcn1.
bamΔ86/bamΔ59 is rescued by bam4.1.Venus
bamΔ86 is rescued by bam-198+133.GFP
bamΔ86 is rescued by bamUASp.GFP/Scer\GAL4VP16.bam
bamΔ86 is rescued by bam-898+133.GFP
bamΔ86 is rescued by bam-498+133.GFP
bamΔ86/bamBG is partially rescued by bam4.1.Venus
bamΔ86 is not rescued by bam-96+133.GFP
Expression of bam4.1.T:Avic\GFP-YFP.Venus restores fertility of the otherwise sterile bamΔ59/bamΔ86 females and bamBG/bamΔ86 males, although under sperm exhaustion conditions the rescue is not complete. Ovaries of the rescue females have wild-type morphology.
The fertility of bamΔ59/bamΔ86;bam4.1.T:Avic\GFP-YFP.Venus rescue flies is neither increased nor diminished by Wolbachia pipientis infection.
D. McKearin.
Distribution of Sxl product in ovaries is abnormal, the transtition from cytoplasmic to nuclear distribution does not occur. Most if not all of the small germ cells that populate the tumorous cysts show high levels of Sxl protein. Small amount of male specific Sxl splicing can be detected in the ovaries but the level of Sxl protein is not affected.