FB2026_02 , released June 18, 2026
Allele: Dmel\Vps25A3
Open Close
General Information
Symbol
Dmel\Vps25A3
Species
D. melanogaster
Name
FlyBase ID
FBal0197871
Feature type
allele
Associated gene
Associated Insertion(s)
Carried in Construct
Key Links
Genomic Maps

Nature of the Allele
Progenitor genotype
Cytology
Description

Deletion of 28 base pairs (tgtacgactgggtgcaggaaacgggcca) and the insertion of a c base in the region encoding V109-Q118. As a result VYDWVQETGQT turns into AT in the mutant.

Mutations Mapped to the Genome
Curation Data
Type
Location
Additional Notes
References
Inserted_sequence:

C

Comment:

Vps25[A3] is a deletion of 28 base pairs (TGTACGACTGGGTGCAGGAAACGGGCCA) and the insertion of a "C" base in the region encoding V109-Q118. As a result VYDWVQETGQT turns into AT in the mutant.

Variant Molecular Consequences
Associated Sequence Data
DNA sequence
Protein sequence
 
Expression Data
Reporter Expression
Additional Information
Statement
Reference
 
Marker for
Reflects expression of
Reporter construct used in assay
Human Disease Associations
Disease Ontology (DO) Annotations
Models Based on Experimental Evidence ( 1 )
Disease
Evidence
References
Modifiers Based on Experimental Evidence ( 1 )
Disease
Interaction
References
Comments on Models/Modifiers Based on Experimental Evidence ( 0 )
 
Disease-implicated variant(s)
 
Phenotypic Data
Phenotypic Class
Phenotype Manifest In
Detailed Description
Statement
Reference

Vps25A3/Vps25A3 MARCM ddaC clones show dendrite pruning similar to wild type at 18hr APF.

Germaria that consist mostly of Vps25A3 cells show misalignment of cysts and increased cell numbers between egg chambers.

Third larval instar eye-antennal discs have abnormal morphology.

Vps25A3 mutant eye disc clones exhibit defects in endosomal maturation.

Homozygous Vps25A3 mutant tissue partially survives in mosaic eye discs, and is not completely 'out-competed'. Although mutant ommatidia are not recovered, the wild-type ommatidia composing the adult eyes of mosaic animals are variably overgrown.

Compared with wild-type, egg chambers containing Vps25A3 mutant cells exhibit a loss of plasma membrane, ultimately leading to the formation of clusters of multinucleated cells enclosed by a single actin cytoskeleton, with nuclei rested around clumps of actin-positive structures, possibly also membrane fragments.

Tissue in mutant eye discs (generated using the eyFLP-cell lethal system) loses apicobasal polarity and fails to undergo terminal differentiation. The mutant eye discs show overgrowth compared to wild type.

Larvae containing mutant eye discs generated using the eyFLP-cell lethal system are increased in size compared to control larvae when examined as pupariation commences. The animals do not develop into adults.

Wing discs contain regions of neoplastic overgrowth in animals in which clones have been induced in the wing, haltere and leg discs (using the UbxFLP-cell lethal system). Eye discs are normal in these animals.

Gut cells of mutant larvae show strong accumulation of autophagosomes containing cytoplasmic material, in contrast to control larvae which have few autophagic structures in the gut.

Follicle cells which are part of homozygous Vps25A3 somatic clones lose their cuboidal morphology and pile upon each other, particularly at the poles of egg chambers. Epithelial integrity is also disrupted in Vps25A3 homozygous somatic clones in the wing disc: the mutant cells are round and are arranged in multilayered masses of cells. Morphology of the disc epithelium adjacent to these clones is normal although cell division surrounding the clones is increased. Marker analysis indicates that these mutant cells have lost apical-basal polarity with the membrane taking on a largely apical character. Endosomes in these mutant cells contain high levels of ubiquinated proteins.

The eyes of adults in which homozygous Vps25A3 somatic clones have been induced during larval stages are dramatically overgrown and bulging, despite lacking mutant cells. At larval stages, the eye discs of these animals are enlarged. The mutant cells themselves do not overgrow, but instead express cell death makers and fail to form ommatidial clusters or express neuronal markers. However, there is an increase in cell division (as assayed by BrdU incorporation) in surrounding wild-type cells. This increase is seen more than 10 cell diameters from the clones but is only seen in cells anterior to the morphogenetic furrow.

In larvae containing eye discs which completely made up of Vps25A3 homozygous somatic clone cells (generated using an Scer\FLP1ey.PN, Scer\FRT, cell lethal system), the larval phase that is extended for more than 3 days after wild-type animals have pupated during which time they continue to grow and only show initial signs of pupariation before dying. The eye discs in these animals lose epithelial integrity but do not overgrow during control larval stages. However, massive overproliferation occurs in these discs during the extended larval stage when wild-type siblings have pupated.

External Data
Interactions
Show genetic interaction network for Enhancers & Suppressors
Phenotypic Class
Suppressed by
Phenotype Manifest In
Suppressed by
Statement
Reference
Enhancer of
Statement
Reference

Vps25[+]/Vps25A3 is an enhancer of eye photoreceptor cell phenotype of Hsap\HTTGMR.Q120

Suppressor of
Statement
Reference

Vps25A3 is a suppressor of wing vein L5 phenotype of Df(3L)ru-22/rhove-1

Vps25A3 is a suppressor of wing vein L5 phenotype of rhove-1

Other
Additional Comments
Genetic Interactions
Statement
Reference

A Vps25A3 heterozygous background leads to approximately 90% suppression of the L5 wing vein defect in rhove-1/rhove-1 kst1 flies.

Vps25A3 and Pi3K59FΔm22 double mutant clones generated in the fat-body or eye-disc show accumulation of autophagosomes under fed conditions, compared to none observed in Pi3K59FΔm22 single mutant clones.

Pi3K59FΔm22 and Vps25A3 double mutant fat-body cells show disruptions in endocytosis.

Stat92E06346/+ partially suppresses the overgrowth of wild-type adult eye tissue caused by Vps25A3 homozygous somatic clones.

Xenogenetic Interactions
Statement
Reference

The loss of photoreceptors that is seen in flies expressing Hsap\HDGMR.Q120 is enhanced if the flies also carry one copy of Vps25A3.

Complementation and Rescue Data
Rescued by
Comments

Vps25hs.PV rescues epithelial integrity in Vps25A3 homozygous somatic clones in the eye disc.

Images (0)
Mutant
Wild-type
Stocks (1)
Notes on Origin
Discoverer
External Crossreferences and Linkouts ( 0 )
Synonyms and Secondary IDs (2)
References (19)