Open Close
General Information
D. melanogaster
FlyBase ID
Feature type
Associated gene
Associated Insertion(s)
Carried in Construct
Allele class
    Nature of the Allele
    Allele class
    Mutations Mapped to the Genome
    Additional Notes
    Associated Sequence Data
    DNA sequence
    Protein sequence
    Progenitor genotype
    Carried in construct
    Nature of the lesion

    UASp regulatory sequences drive expression of an shRNA (ACCGAGGTGTCCGATCTCAAA) directed against egl.

    Allele components
    Product class / Tool use(s)
    Encoded product / tool
    Expression Data
    Reporter Expression
    Additional Information
    Marker for
    Reflects expression of
    Reporter construct used in assay
    Human Disease Associations
    Disease Ontology (DO) Annotations
    Models Based on Experimental Evidence ( 0 )
    Modifiers Based on Experimental Evidence ( 0 )
    Comments on Models/Modifiers Based on Experimental Evidence ( 0 )
    Phenotypic Data
    Phenotypic Class
    Phenotype Manifest In
    Detailed Description

    Expression of egldsRNA.shRNA-2.Scer\UAS.P\T under the control of Scer\GAL4mat.╬▒Tub67C.T:Hsim\VP16 fails to deplete egl protein levels and has no effect on the localization of stau protein or osk mRNA.

    External Data
    Show genetic interaction network for Enhancers & Suppressors
    Phenotypic Class
    Phenotype Manifest In
    Additional Comments
    Genetic Interactions
    Xenogenetic Interactions
    Complementation and Rescue Data
    Images (0)
    Stocks (0)
    Notes on Origin
    External Crossreferences and Linkouts ( 0 )
    Synonyms and Secondary IDs (2)
    Reported As
    Symbol Synonym
    Name Synonyms
    Secondary FlyBase IDs
      References (1)