UAS regulatory sequences drive expression of a short inverted repeat (21nt CAGGACGATCCGACAGAAGAA sequence).
Expression of TAF1BdsRNA.Scer\UAS under the control of Scer\GAL4ey.200.Exel results in a rough eye phenotype in adult flies and frequent appearance of malformations resembling an antennal-like structure in the eyes.
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has visible | adult stage phenotype, enhanceable by Utx[+]/Utx1
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has visible | adult stage phenotype, enhanceable by NO66UASp.Tag:HA, Scer\GAL4ey.200.Exel
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has visible | adult stage phenotype, non-enhanceable by JHDM2[+]/Kdm3KO
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has visible | adult stage phenotype, non-enhanceable by Jarid2[+]/Jarid2KO
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has visible | adult stage phenotype, non-enhanceable by Df(3R)HSPBAP1-KO/+
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has visible | adult stage phenotype, non-enhanceable by JMJD4[+]/JMJD4KO
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has visible | adult stage phenotype, non-enhanceable by Kdm4A[+]/Kdm4AKO
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has visible | adult stage phenotype, non-enhanceable by JMJD5[+]/JMJD5KO
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has visible | adult stage phenotype, non-enhanceable by Kdm4B[+]/Kdm4BKO
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has visible | adult stage phenotype, non-enhanceable by lid[+]/Kdm510424
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has visible | adult stage phenotype, non-enhanceable by Kdm2KO/Kdm2[+]
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has visible | adult stage phenotype, non-enhanceable by PSR[+]/JMJD6FM1
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has visible | adult stage phenotype, non-enhanceable by JMJD7[+]/JMJD7KO
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has visible | adult stage phenotype, suppressible | partially by NO66[+]/NO66KO
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has visible | adult stage phenotype, non-suppressible by lid[+]/Kdm510424
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has visible | adult stage phenotype, non-suppressible by Kdm2KO/Kdm2[+]
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has visible | adult stage phenotype, non-suppressible by Kdm4B[+]/Kdm4BKO
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has visible | adult stage phenotype, non-suppressible by PSR[+]/JMJD6FM1
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has visible | adult stage phenotype, non-suppressible by JMJD7[+]/JMJD7KO
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has visible | adult stage phenotype, non-suppressible by JHDM2[+]/Kdm3KO
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has visible | adult stage phenotype, non-suppressible by Jarid2[+]/Jarid2KO
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has visible | adult stage phenotype, non-suppressible by Df(3R)HSPBAP1-KO/+
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has visible | adult stage phenotype, non-suppressible by JMJD4[+]/JMJD4KO
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has visible | adult stage phenotype, non-suppressible by Kdm4A[+]/Kdm4AKO
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has visible | adult stage phenotype, non-suppressible by JMJD5[+]/JMJD5KO
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has eye phenotype, enhanceable by Utx[+]/Utx1
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has eye phenotype, enhanceable by NO66UASp.Tag:HA, Scer\GAL4ey.200.Exel
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has eye phenotype, non-enhanceable by JHDM2[+]/Kdm3KO
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has eye phenotype, non-enhanceable by Jarid2[+]/Jarid2KO
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has eye phenotype, non-enhanceable by Df(3R)HSPBAP1-KO/+
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has eye phenotype, non-enhanceable by JMJD4[+]/JMJD4KO
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has eye phenotype, non-enhanceable by Kdm4A[+]/Kdm4AKO
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has eye phenotype, non-enhanceable by JMJD5[+]/JMJD5KO
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has eye phenotype, non-enhanceable by Kdm4B[+]/Kdm4BKO
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has eye phenotype, non-enhanceable by lid[+]/Kdm510424
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has eye phenotype, non-enhanceable by Kdm2KO/Kdm2[+]
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has eye phenotype, non-enhanceable by PSR[+]/JMJD6FM1
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has eye phenotype, non-enhanceable by JMJD7[+]/JMJD7KO
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has eye phenotype, suppressible | partially by NO66[+]/NO66KO
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has eye phenotype, non-suppressible by lid[+]/Kdm510424
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has eye phenotype, non-suppressible by Kdm2KO/Kdm2[+]
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has eye phenotype, non-suppressible by PSR[+]/JMJD6FM1
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has eye phenotype, non-suppressible by JMJD7[+]/JMJD7KO
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has eye phenotype, non-suppressible by JHDM2[+]/Kdm3KO
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has eye phenotype, non-suppressible by Jarid2[+]/Jarid2KO
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has eye phenotype, non-suppressible by Df(3R)HSPBAP1-KO/+
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has eye phenotype, non-suppressible by JMJD4[+]/JMJD4KO
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has eye phenotype, non-suppressible by Kdm4A[+]/Kdm4AKO
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has eye phenotype, non-suppressible by JMJD5[+]/JMJD5KO
Scer\GAL4ey.200.Exel, TAF1BRNAi.UAS has eye phenotype, non-suppressible by Kdm4B[+]/Kdm4BKO
The frequency of eye tissue to antenna-like malformed structures transformation in adult flies expressing TAF1BdsRNA.Scer\UAS under the control of Scer\GAL4ey.200.Exel is increased by co-expression of NO66Scer\UAS.P\T.T:Ivir\HA1 or by combination with a single copy of Utx1, decreased by combination with NO66KO and not significantly affected by combination with any of the following: lid10424, Kdm2KO, PSRFM1, JMJD7KO, JHDM2KO, Jarid2KO, Df(3R)HSPBAP1-KO, JMJD4KO, Kdm4AKO, JMJD5KO or Kdm4BKO.