Open Close
General Information
Symbol
Dmel\TAF1BdsRNA.UAS
Species
D. melanogaster
Name
FlyBase ID
FBal0335421
Feature type
allele
Associated gene
Associated Insertion(s)
Carried in Construct
Key Links
Allele class
Nature of the Allele
Allele class
Mutations Mapped to the Genome
 
Type
Location
Additional Notes
References
Associated Sequence Data
DNA sequence
Protein sequence
 
 
Progenitor genotype
Carried in construct
Cytology
Nature of the lesion
Statement
Reference

UAS regulatory sequences drive expression of a short inverted repeat (21nt CAGGACGATCCGACAGAAGAA sequence).

Allele components
Product class / Tool use(s)
Encoded product / tool
Expression Data
Reporter Expression
Additional Information
Statement
Reference
 
Marker for
Reflects expression of
Reporter construct used in assay
Human Disease Associations
Disease Ontology (DO) Annotations
Models Based on Experimental Evidence ( 0 )
Disease
Evidence
References
Modifiers Based on Experimental Evidence ( 0 )
Disease
Interaction
References
Comments on Models/Modifiers Based on Experimental Evidence ( 0 )
 
Disease-implicated variant(s)
 
Phenotypic Data
Phenotypic Class
Phenotype Manifest In
Detailed Description
Statement
Reference

Expression of TAF1BdsRNA.Scer\UAS under the control of Scer\GAL4ey.200.Exel results in a rough eye phenotype in adult flies and frequent appearance of malformations resembling an antennal-like structure in the eyes.

External Data
Interactions
Show genetic interaction network for Enhancers & Suppressors
Phenotypic Class
Enhanced by
NOT Enhanced by
Statement
Reference
Suppressed by
Statement
Reference
NOT suppressed by
Statement
Reference
Phenotype Manifest In
Enhanced by
NOT Enhanced by
Statement
Reference

Scer\GAL4ey.200.Exel, TAF1BdsRNA.UAS has eye phenotype, non-enhanceable by JMJD7[+]/JMJD7KO

Scer\GAL4ey.200.Exel, TAF1BdsRNA.UAS has eye phenotype, non-enhanceable by JHDM2[+]/Kdm3KO

Scer\GAL4ey.200.Exel, TAF1BdsRNA.UAS has eye phenotype, non-enhanceable by Jarid2[+]/Jarid2KO

Scer\GAL4ey.200.Exel, TAF1BdsRNA.UAS has eye phenotype, non-enhanceable by JMJD4[+]/JMJD4KO

Scer\GAL4ey.200.Exel, TAF1BdsRNA.UAS has eye phenotype, non-enhanceable by Kdm4A[+]/Kdm4AKO

Scer\GAL4ey.200.Exel, TAF1BdsRNA.UAS has eye phenotype, non-enhanceable by JMJD5[+]/JMJD5KO

Scer\GAL4ey.200.Exel, TAF1BdsRNA.UAS has eye phenotype, non-enhanceable by Kdm4B[+]/Kdm4BKO

Scer\GAL4ey.200.Exel, TAF1BdsRNA.UAS has eye phenotype, non-enhanceable by lid[+]/Kdm510424

Scer\GAL4ey.200.Exel, TAF1BdsRNA.UAS has eye phenotype, non-enhanceable by Kdm2KO/Kdm2[+]

Scer\GAL4ey.200.Exel, TAF1BdsRNA.UAS has eye phenotype, non-enhanceable by PSR[+]/JMJD6FM1

Suppressed by
Statement
Reference

Scer\GAL4ey.200.Exel, TAF1BdsRNA.UAS has eye phenotype, suppressible | partially by NO66[+]/NO66KO

NOT suppressed by
Statement
Reference

Scer\GAL4ey.200.Exel, TAF1BdsRNA.UAS has eye phenotype, non-suppressible by JHDM2[+]/Kdm3KO

Scer\GAL4ey.200.Exel, TAF1BdsRNA.UAS has eye phenotype, non-suppressible by Jarid2[+]/Jarid2KO

Scer\GAL4ey.200.Exel, TAF1BdsRNA.UAS has eye phenotype, non-suppressible by JMJD4[+]/JMJD4KO

Scer\GAL4ey.200.Exel, TAF1BdsRNA.UAS has eye phenotype, non-suppressible by Kdm4A[+]/Kdm4AKO

Scer\GAL4ey.200.Exel, TAF1BdsRNA.UAS has eye phenotype, non-suppressible by JMJD5[+]/JMJD5KO

Scer\GAL4ey.200.Exel, TAF1BdsRNA.UAS has eye phenotype, non-suppressible by Kdm4B[+]/Kdm4BKO

Scer\GAL4ey.200.Exel, TAF1BdsRNA.UAS has eye phenotype, non-suppressible by lid[+]/Kdm510424

Scer\GAL4ey.200.Exel, TAF1BdsRNA.UAS has eye phenotype, non-suppressible by Kdm2KO/Kdm2[+]

Scer\GAL4ey.200.Exel, TAF1BdsRNA.UAS has eye phenotype, non-suppressible by PSR[+]/JMJD6FM1

Scer\GAL4ey.200.Exel, TAF1BdsRNA.UAS has eye phenotype, non-suppressible by JMJD7[+]/JMJD7KO

Additional Comments
Genetic Interactions
Statement
Reference

The frequency of eye tissue to antenna-like malformed structures transformation in adult flies expressing TAF1BdsRNA.Scer\UAS under the control of Scer\GAL4ey.200.Exel is increased by co-expression of NO66Scer\UAS.P\T.T:Ivir\HA1 or by combination with a single copy of Utx1, decreased by combination with NO66KO and not significantly affected by combination with any of the following: lid10424, Kdm2KO, PSRFM1, JMJD7KO, JHDM2KO, Jarid2KO, Df(3R)HSPBAP1-KO, JMJD4KO, Kdm4AKO, JMJD5KO or Kdm4BKO.

Xenogenetic Interactions
Statement
Reference
Complementation and Rescue Data
Comments
Images (0)
Mutant
Wild-type
Stocks (0)
Notes on Origin
Discoverer
External Crossreferences and Linkouts ( 0 )
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
TAF1BdsRNA.Scer\UAS
TAF1BdsRNA.UAS
Name Synonyms
Secondary FlyBase IDs
    References (1)