Open Close
General Information
Symbol
Dmel\Bxmut2-miR-263b
Species
D. melanogaster
Name
FlyBase ID
FBal0355570
Feature type
allele
Associated gene
Associated Insertion(s)
Carried in Construct
Key Links
Mutagen
Nature of the Allele
Mutations Mapped to the Genome
 
Type
Location
Additional Notes
References
Comment:

A single base substitution (A to G at X:18571692 ) in the seed sequence of one of two mir-263b binding sites within the 3' UTR of Bx. This change is in the context of sa total of seven base substitutions in the vicinity. The net change is that the annotated region (GCTCGAAGCGTGCGGTGCCAAAAGAAATTCAAAGCAGTGCCAA) is replaced with CCCCCAAGCGTGGGGTGCCAAAAGAAATTCAAGACAGTGCCAG.

Inserted_sequence:

CCCCCAAGCGTGGGGTGCCAAAAGAAATTCAAGACAGTGCCAG

Associated Sequence Data
DNA sequence
Protein sequence
 
 
Progenitor genotype
Cytology
Nature of the lesion
Statement
Reference

Mutation in the seed sequence of the two mir-263b binding sites within the 3' UTR of Bx.

Expression Data
Reporter Expression
Additional Information
Statement
Reference
 
Marker for
Reflects expression of
Reporter construct used in assay
Human Disease Associations
Disease Ontology (DO) Annotations
Models Based on Experimental Evidence ( 0 )
Disease
Evidence
References
Modifiers Based on Experimental Evidence ( 0 )
Disease
Interaction
References
Comments on Models/Modifiers Based on Experimental Evidence ( 0 )
 
Disease-implicated variant(s)
 
Phenotypic Data
Phenotypic Class
Phenotype Manifest In
Detailed Description
Statement
Reference

Bxmut2-miR-263b adults show decreased circadian rhythmicity and circadian power under constant dark, and lack morning anticipation activity under light-dark cycles, as compared to wild-type controls.

Bxmut2-miR-263b adults show disrupted circadian plasticity of sLNv dorsal projections, as mutants show a lower number of axon terminal branches at ZT2 than controls.

External Data
Interactions
Show genetic interaction network for Enhancers & Suppressors
Phenotypic Class
Phenotype Manifest In
Additional Comments
Genetic Interactions
Statement
Reference
Xenogenetic Interactions
Statement
Reference
Complementation and Rescue Data
Comments
Images (0)
Mutant
Wild-type
Stocks (0)
Notes on Origin
Discoverer
External Crossreferences and Linkouts ( 0 )
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
Bxmut2-miR-263b
Name Synonyms
Secondary FlyBase IDs
    References (1)