mut2456, mutated to UUUUUUUGCUCUCUCAUUUUUUUGCUCUCUCUCUCUCUCUCUCUCU
EFmut, mutated to CUCUCUCUAGCAUGAACUCUCUCUAGCACGUGAACCUAGGAUUAAG
mut2456, mutated to UUUUUUUGCUCUCUCAUUUUUUUGCUCUCUCUCUCUCUCUCUCUCU
Interaction in vitro; bait produced as a recombinant fusion protein in bacterial system; prey produced and labeled by in vitro transcription.
Source was adult females; bait produced from endogenous gene; prey produced from endogenous gene.
for site B in 5-prime UTR, T16 mutated to (CT)8; for sites E,F in 3-prime UTR, U7G mutated to (CT)4
Interaction in vitro; bait produced by in vitro transcription; prey derived from wild-type embryonic extract.
for site B in 5-prime UTR, T16 mutated to (CT)8; for sites E,F in 3-prime UTR, U7G mutated to (CT)4
Interaction in vitro; bait produced by in vitro transcription; prey derived from wild-type embryonic extract.
Positive control.
Interaction in vitro; bait produced as a recombinant fusion protein in bacterial system; prey derived from wild-type embryonic extract.
Positive control.
Interaction in vitro; bait produced as a recombinant fusion protein in bacterial system; prey derived from wild-type embryonic extract.
H213A, coordinates refer to Unr-PA
R239A, coordinates refer to Unr-PA
Interaction in vitro; bait produced as a recombinant fusion protein in bacterial system; prey produced and labeled by in vitro transcription.
Interaction shown as supershift of msl-2-Sxl complex.
Interaction in vitro; protein produced as recombinant fusion protein in bacterial system; mRNA produced by in vitro transcription.
Interaction in vitro; protein produced as recombinant fusion protein in bacterial system; mRNA produced by in vitro transcription.
Interaction in vitro; protein produced as recombinant fusion protein in bacterial system; mRNA produced by in vitro transcription.
UUUUUUUG to (CU)4
Recombinant GST-Sxl RNA binding domain 4 was added to RNA affinity column along with embryo extract.
Interaction in vitro; bait produced and labeled by in vitro transcription; prey derived from wild-type embryo extract.