Gene or accession: CG13480 Gene annotation error Genes CG13480 and Leucokinin should be merged. Comments: Amino acid and nucleotide sequence of Celera CG13480 (AE003534; AAF49731) and Leucokinin (AF192342; AAF20066) are 100% identical so please merge the genes. Leucokinin translation is just 31 amino acids but based on identity and same cytological location (70E) I believe these are the same genes. Clustal of C terminal CG13480 nucleotide sequence and complete Leucokinin is below. cel_xxxxx TTCTCGCCCATCATCCGGGATGCGGTGATTGAAAGGTGCCGCATCAAATCCCAGCTGCAG leuc_xxxxx \-------------------------TGATTGAAAGGTGCCGCATCAAATCCCAGCTGCAG cel_xxxxx CGCGACGAGAAGCGCAACTCCGTCGTGCTGGGCAAGAAGCAGCGATTCCACTCGTGGGGC leuc_xxxxx CGCGACGAGAAGCGCAACTCCGTCGTGCTGGGCAAGAAGCAGCGATTCCACTCGTGGGGC cel_xxxxx GGCAAAAGGTCACCGGAACCACCGATCCTGCCGGACTACTAA leuc_xxxxx GGCAAAAGGTCACCGGAACCACCGATCCTGCCGGACTACTAA thanks