Open Close
Reference
Citation
Cook, K., Garton, R., Brown, A., Ward, M., Deal, J., Kaufman, T., Cook, K. (2011.1.3). Basal X chromosome segments present on Dp(1;Y)BSC chromosomes. 
FlyBase ID
FBrf0212678
Publication Type
Personal communication to FlyBase
Abstract
PubMed ID
PubMed Central ID
Text of Personal Communication
Basal X chromosome segments present on Dp(1;Y)BSC chromosomes
Kim Cook, Russell Garton, Adam Brown, Megan Ward, Jennifer Deal, Megan Deal, Thom Kaufman & Kevin Cook
Bloomington Drosophila Stock Center
Indiana University
We have generated Y-linked duplications of X chromosomal segments by irradiating an attached-XY (C(1;Y)N12) with an inversion in the X chromosome. Irradiation produces a Dp(1;Y) chromosome by inducing a large deletion in the progenitor chromosome with one breakpoint within the inversion and another breakpoint in X heterochromatin or basal X euchromatin. The region distal to the deletion on a Dp(1;Y) consists of two parts: X tip genes distal to the inversion and genes from the middle of the X moved near the end of the X by the inversion. The distal and medial duplicated segments present on particular Dp(1;Y)BSC chromosomes have been described in other personal communications to FlyBase. 
The region of a Dp(1;Y) proximal to the deletion will carry no basal euchromatic genes if the proximal deletion breakpoint falls in X heterochromatin. When the proximal deletion breakpoint falls in basal X euchromatin, however, basal euchromatic genes will be present. This personal communication describes the basal X segments present on Dp(1;Y)s derived from In(1)BSC2  and In(1)BSC12.
We mapped the distal extents of the basal segments to ~10 gene intervals defined by PCR primers using the following approach. Males carrying a Dp(1;Y) were crossed to females carrying a transposable element insertion in a basal X position. Primers flanking the insertion sites of the transposable elements were used to amplify fragments from DNA isolated from male progeny. With short extension times, fragments are amplified only if the site of the transposable element insertion is present on the Dp(1;Y). The following transposable elements and primer pairs were used in mapping:
Insertion: P{SUPor-P}slgAKG07965
Forward primer: CCTTTGCAGCTGCAACTGTCCGAGG ( X:21253567..21253591 )
Reverse primer: CGGCTGGAAGTAAGTCTGCTCCG ( X:21254094..21254116 )
Insertion: P{EPgy2}EY09781
Forward primer: CGCACAGGTCTTGAAGGCATTGCC ( X:21443126..21443149 )
Reverse primer: GTTTCTAGCAGCCCCCTTCGCACCG ( X:21443688..21443712 )
Insertion: P{Mae-UAS.6.11}CG14619GG01842
Forward primer: CATCGCTCGCGCGCACAATCTCGGC ( X:21858117..21858141 )
Reverse primer: GTGCCGCCAGGCTGTCTACGCTCC ( X:21858613..21858636 )
Insertion: P{GT1}BG01274
Forward primer: CTAGTGTATTTGCCTTCACCATAATCG ( X:21961730..21961756 )
Reverse primer: GAGCGAGGAATATCTGATATGCGG ( X:21962214..21962237 )
Insertion: PBac{WH}f02323
Forward primer: GATGGCGGTGTCCTTGTCTCTGGC ( X:22366703..22366726 )
Reverse primer: CCTGTGACATTAATGCAGGCGACGG ( X:22367213..22367237 )
The following basal segments are present on Dp(1;Y)s (Release 5 coordinates and predicted cytologies).  These Dp(1;Y)s carry basal euchromatic genes: 
Dp(1;Y)BSC222   X:21253567--21443126 ;h28-h29 (20A1-20A3;h28--h29)
Dp(1;Y)BSC262   X:21443126--21858117 ;h28--h29 (20A3-20C1;h28--h29)
Dp(1;Y)BSC264   X:21443126--21858117 ;h28--h29 (20A3-20C1;h28--h29)
PBac{WH}f02323, an insertion immediately distal to stnA in 20F3, was the most basal transposon insertion site we tested by PCR.  The following Dp(1;Y)s do not carry this insertion site and, consequently, do not duplicate basal euchromatic genes distal to stnA. 
Dp(1;Y)BSC214
Dp(1;Y)BSC215
Dp(1;Y)BSC216
Dp(1;Y)BSC217
Dp(1;Y)BSC218
Dp(1;Y)BSC219
Dp(1;Y)BSC220
Dp(1;Y)BSC221
Dp(1;Y)BSC252
Dp(1;Y)BSC253
Dp(1;Y)BSC254
Dp(1;Y)BSC255
Dp(1;Y)BSC256
Dp(1;Y)BSC257
Dp(1;Y)BSC258
Dp(1;Y)BSC259
Dp(1;Y)BSC260
Dp(1;Y)BSC261
Dp(1;Y)BSC263
DOI
Associated Information
Comments
Associated Files
Other Information
Secondary IDs
    Language of Publication
    English
    Additional Languages of Abstract
    Parent Publication
    Publication Type
    Abbreviation
    Title
    ISBN/ISSN
    Data From Reference