Open Close
General Information
Symbol
Dmel\GMR42B01
Species
D. melanogaster
Feature type
FlyBase ID
FBsf0000441705
Collection
Associated gene
Genomic Location
Chromosome (arm)
3R
Sequence location

3R:7,967,735..7,971,550

Sequence Data
Length
Comments
Associated Information
Experimental Data
Progenitors
PCR template
Primer 1
ggtgtcacgatatcagcttagggtt
Primer 2
gaagggcatttctttcatcggttcc
Comments
Collection Information
Collection: GMR_Brain_exp_1
Title
A set of GAL4 transgenes designed to be expressed in neuronal tissues.
Source and Progenitors
Species of derivation
D. melanogaster
Strain of derivation
Vector of progenitor construct
Description

Collection of stocks carrying GAL4 transgenes fused to defined putative enhancer fragments from selected D. melanogaster genes; a targeted insertion site is used. The goal is to establish a collection of enhancers driving expression in small subsets of cells in adult brain.

Additional data
Sample preparation
Collection preparation

925 genes for which available expression data or predicted function implied expression in a subset of cells in the adult brain were selected. Spanning the flanking upstream and downstream intergenic regions of these genes, as well as any of their introns larger than 300 bp, regions were selected for testing that averaged 3 kb in length and overlapped (in regions that could not be covered by a single fragment) by approximately 1 kb. The fragment of genomic DNA to be tested for enhancer activity was generated by PCR, cloned into a Gateway donor vector, and verified by DNA sequencing. Site-specific recombination was used to transfer the fragment into the integration vector pBPGUw or pBPGw. Constructs in pBPGUw use a Drosophila synthetic core promoter (DSCP). Constructs in pBPGw use the putative endogenous promoter of the selected gene. Constructs were inserted into the P{CaryP}attP2 target element by phiC31 site-specific integration. Expression of GAL4 was detected either directly by in situ hybridization to the GAL4 mRNA or by assaying expression of a UAS-GFP fusion gene.

Mode of assay
Data analysis
Cell lines
Observed in
Not observed in
Comments
Stocks (2)
External Crossreferences and Linkouts ( 0 )
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
Secondary FlyBase IDs
    References (4)