Open Close
General Information
Symbol
VAS1
FlyBase ID
FBto0000181
Name
variable activating sequence 1
Description
Description

The 20bp VAS1 DNA sequence (TAGTCGACCCCGCGGGTAGT) is an artificial sequence designed to be specifically and robustly bound by the TALE repeat present in the TALE1::VP64 driver. VAS1 and TALE1::VP64 thus form a binary expression system that can be used to control the spatial and temporal expression of a gene of interest: a transgene or modified endogenous locus carrying the target gene of interest downstream of VAS1 sequences is combined with a second transgene or modified endogenous locus encoding the TALE1::VP64 driver expressed in the required expression pattern (FBrf0237269).

External Crossreferences and Linkouts
Related experimental tools
Transgenic Constructs
Has tool as regulatory region (1)
Transgenic construct(s)
Component allele
Reg. region
Encoded product / tool
Tagged with
Also carries
Stocks
Insertions ( 0 )
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
VAS1
Name Synonyms
variable activating sequence 1
Secondary FlyBase IDs
    References (2)