Open Close
General Information
Symbol
Dmel\Axud1-RB
Species
D. melanogaster
Annotation Symbol
CG4272-RB
FlyBase ID
FBtr0077763
Feature type
Associated gene
Evidence Rank
Length (nt)
3807
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 24 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TTGTCATGTTGCAGGGGTCCAGCGACGGGCACACTGAATAGAAGAAATGACCAAAGGACACTCAATGATCTAGGGACCTC
        GACACGGATAGCATGTTTAGTCCTATAAAAAAAATATTTACGTACATACAAAAAAATGCGAGCGGCTCCAATATGTTTAG
        CCCATCAGGAAACAAGGCCGCCGGCCAAAGGGAGGGGACCACCAGCCTAACTGCCCACGACGAAGGCGAAAGGAAGGATC
        AGCGGCATCTGGATCACAAGGATAATCAGAGCGAACCGGAGGAGCGGCAGCATCAGCTGCAAATATTTCCCCACCTGGAC
        GATGACGACGACGACATCGAGAGGCAGATCAAAACCTCCATAATTGACGCCAGCAAGGTGCACGCAGCGAAAGCCAAGGC
        GTTGGCTTCCCTACCCATGCCGCTTGAGCAGCTCGATGATGAACTGGCGGACTTTGCTCACGGCCCGGCGGACACCGAAC
        TAGAGGAGCAGTTCCTTGAGCTGGAGAACTATCCTAATAATGAGATAATCGTACTAGGCGATGCGGATCTTAACTCTTCA
        ATAGCTTCCGACGCAGTCTCCGAGGACCCACTGGCAATTGACAACATTCTTGACTCCGCGTCGGTCACCACAAACGAGGA
        GGTCGACACCAGTGGAGAACTTCTTTGGCTGAAGTTGAACAATGAGACGGAAATGGCCACCAGATCAGCGGAGGTGGTGT
        CCAACAACCAAGCATCATTGGAGCCTGCCCAGCCAGCCAAACCGAAAGAGGATGAGCTTAGAGATGGTGGGTCTGATTCT
        GGTTTAGGAAGTGAAACCTCCGCGTTACTCAAGGATCAGGCGGAGAAAGAAGCCGAGCCGGAAATCCAGAAAAAGGTGGA
        AACGAAGCCCATAAGGTCCAACCTTAAACGGAGACTCGAAGATTCGGAAAGCGATGCTATAGATCTGGTGCCCGACATGT
        CTGCCCCTCCAGTAGCCCCCCAGAAGCGGACTAAGCGCTCCATCAACTTTGACGAGGTGAAGGTGTTCTACTTCCCACGA
        CAACAGGGCTTCAGTTGTGTACCAACGGCGGGCGGATGCACCTTGGGCATGGGTGCAAGGCATGTAGGTTTTAAGACGAT
        GACCCTGGCCGAGCACGCAGCGGAGTTGAGGCGGGCACATCGCAGCCAGAACCAAGAACTCCAGCCTCGGGGTTCCAGCA
        GTGACGACAGCGAGGAGTCCGAGGAGGATTACCTAAGCGAGGGTAGTGGCTCCGATGCCGAAGACGGTTCCAATGGCTTC
        CTACAGCCGGTGACGCCCAAGCAGAGAAGGGCACTGCTGAAAGCGGCGGGCGTGCGCAAAATTGATGCCAGCGAGAAGAG
        CGAATGCCGCGATATCAGAAACTCCCGGGAAGTGTGCGGCTGCTCCTGCAGAGAGTTTTGCGATCCGGAGACTTGTGCCT
        GCAGCCAGGCGGGCATTAAATGTCAAGTAGATCGAGCCATGTTTCCTTGCGGATGTACTCGCGAAGCTTGTGGCAACACA
        GTTGGCCGGGTAGAGTTCAATCCCACGAGGGTGCGAACCCACTATATCCACACGGTGATGCGGTTGGATCTCGAGCAGCG
        ACAGGGTTCGGTTCAAGGCGTCCAGGGAGGACATCTGCAGCCGCAACAGCAGCAACCATCCCAACAGACCATTGGCTATT
        CCCCGGTGGGAACGGCTGGCTCAACATCCGCGTACTTCCTGCAAACGCAATCGAACTACAGCTCCGGCTACGCTTCACCA
        GCTTACACACCCGAGAGCAGCGTGAGCTACTATCAACAGCAGGTACAGCAGCCAGGAGTGCCCACTGCGGGCCAGTTGAT
        ACCCCAGCAGCAGCAAGCGCAGAGCCAGAGCTACGCGGGCTACGCCCAATTGGACAGCCTGGACTCCGGACTCTTTGCTA
        GTGGCTCCAATGCCACGCCCTCGTACGGAGAACTATATCAGTCGCTCAGCTATGGCAGCACTCAGATCACTTCCTATACG
        GCCGCCTATCAGCAGCATTCGGCGTCACCCGCCGTCGCTGTCGCCCCCGGAGCACCCAGTTCGTGCGCGTATAGCTCCTG
        TGCGGTGCCTTCGGTGCCGCCGTATGGAAATGCAACCACCACCGCCTCCAGCAACGTTCCCTACCAGACCACCGCTGTCT
        CCATGACCGCAGCCTCCACCTCAGCCTCGCCGTCACGACTTGTGGGCAATCCAGTTGGTTCAGCAACAGCCTCGCCAGCC
        ACTGTATCATCTTCTCCTGCAACGGCCAGTGGTAATGAATTTATCAGTTTGAGCACACCGATCGCCAGTTCCTCGCGCCT
        CTCACAGATCAACGATCTGCTGCAGCACAACCGCAACACCACAGCCGCATTAGTGGCCGTCTCCGAGGGATTGAGCGGTG
        GAAGGACCTCGTCCAGTGCATCCACCATTGACTCTATCGACACACCGCCCATTGTGGACGACGGGCAGCAGCGAGGATGC
        ATGAGTTTCGAGGCGTTGCCCCCGCCGCTCGTGAATCCAGCGCCCATTGTCGCCGTGGTGGAGAACAAGCTGCCACCAAT
        GGCATTGCCGGCTCCACATGCTCCTCCATCAGCCCCACAGCCACGCCAGCCGCTGGAACAGCATCATCCAGCGACAAGCG
        AGTCCTCCTAGATTACAAAATCGATTTTTCGGGTTCGCTACTTTGGGCAATTCTCAGTGACTATGAATTGATGGCTAATT
        TTTTTTTTTTTTTTTTTTTTTATCGCTTTAAGTCGATTTTATCCTGATTTTTTTTTAAGATTTTTACTTTGTTTATATAT
        AACACATATATTTAGTCTCTTTTACCGTTTTCTAAATTTATATTTTTTAAGTTAAAGAATATGTAAAACGACACCAATAT
        TTTGTTGCCCAAGTGAAACTTTTTCGCCTCTGGAGCCACTGAAATTGTACCCTTTGTTGCCATAACAATTTCCCTGAGAA
        TTGTGCAAAGCACCAAGAGACACCCACCCTTCAATCGAAACCCGAGGAGGAGGCAGCTGAGAGCTGAGAATAGTTTTTAT
        AGCAATTTTACACAGCAAAAGACTTCATTACGTTTAAGGCGGCGGCGGGCTTGGCTGGAAATGGATTGGACTGCAAATGG
        ATTGGATTAGCAGTGGCAGTAATCAAAATACACATCGTAGGCGTCGCTCATCGACTTCAGGAGGCCTCTTCAGTAGCGGC
        GAGAGTCATCTAATCGGACTCAAGTCGCCTTGTATAAATCATTTTATTGTTAAATTCGAGTTAGTCTCTAAGTACATACT
        GTAGTTTAGTTACTTTGTTGCTTAAGTTAAGTTCACTTCGCAAAATCAAGTTCCCTTCCTACTCAACTTTAATTTTGTAA
        TCTAAAACGAACAAATTGAGGAAGGAAACTTTCTAACGTCGTTACTACTTGCGTTGCTCCAATGAATTTAATGAGCTGAG
        AGCCCCAAAACCCTTTCCTTACCATTCTGTGTCAAATCTGATTTAGCCCAGCTTAACTGAAATCGCTTGTTAACCGATTT
        TGTGTTTTGCATTTTGCATTTAGTTGTGAAGCCAATCTGATTACATACTTTTGTAGATTTATCCTCGATTTAGCTGCGTT
        TAAGTATTCATTTAGCTCTTAAGTTCCTTATTTCTGGCCCTTAGTGTATTAGGCCTAATGAACCAACAACACTTGGCGAA
        ATACACAGAAAAAATAACAACCACAACATGCAGTACGATGTAGAAATACGTATATGCAACTCGATAACGACAAAAGGAAA
        ATAAAAACGAAAAAATAATTGCAATTATTTAAATAAATATTGAATAC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0077762
        4145
        FBtr0330665
        4318
        FBtr0330666
        3896
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0077443
        852
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0077442
        852
        FBpp0303515
        852
        FBpp0303516
        852
        Comments
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        Axud1-RB
        CG4272-RB
        Secondary FlyBase IDs
          References (2)