Open Close
General Information
Symbol
Dmel\Rel-RA
Species
D. melanogaster
Annotation Symbol
CG11992-RA
FlyBase ID
FBtr0089338
Feature type
Associated gene
Evidence Rank
Length (nt)
3499
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 77 )
Sequence
TATTCAAATAAATGAATTTGAACCGTAGTTTCCGTGAAAAGCTGACCCGAAAGCTCGGCGCAAATAGCTTAAACCTGTTA
TCAGGGCAGCGAGCGTTTTGCTCGCAACTCGTGAGCGATACTACTTGTGTTCGCGCAGTGCTTCGTTCATTTTCGTTCCA
GCAGTGGCGCACTAAAGTTCCCCGATTCGCTGCGTCGTTTTTCCATAAATTTGCATATATGTATTAGTTGGGTGGAATAC
ATATAAACAGTGTGATTTCGCTCTGTAAACAACAACCGCGAATCCAGAATTCCGTACATGCTTATAGTATAGCCGATCAA
AAAAATCACACTGAGTGGTGCGCCAGAAAAACCCGTGAGTCATCTCGACGTGGCCGCCGCAGATAATTTCCCATCCGCCG
AACATCGGGGAAGTACCTAAAACGAATGGTCAGCCATCGGCGGAGCTCGTTTCGATCATTAGCGTTCCGATCGGCGAAGG
CAGCGGATCACTTTTGAGTTGTTAAGACGCTATTGATCAGAAATATTGGATTGATACGGACTATGAACATGAATCAGTAC
TACGACCTGGACAATGGGAAAAATGTGATGTTTATGAACGATGCATCCAGCACCAGTGGCTATAGCAGCAGTACATCACC
CAACTCCACCAACCGATCCTTTTCACCAGCCCACTCCCCGAAAACCATGGAACTGCAAACGGACTTCGCCAATCTTAATT
TGCCCGGCGGCAATTCACCACACCAGCCGCCAATGGCAAACTCACCATACCAGAATCAGCTGTTGAACAACGGCGGAATT
TGCCAATTGGGTGCTACCAATTTAATAAACTCCACTGGCGTTAGTTTCGGCGTTGCTAATGTCACCAGTTTTGGCAACAT
GTACATGGATCACCAGTACTTTGTGCCCGCTCCGGCCACTGTGCCACCGTCCCAAAACTTTGGATACCATCAAAATGGCC
TGGCATCTGACGGCGATATCAAACACGTGCCGCAGCTGCGGATCGTTGAGCAACCGGTGGAGAAGTTCCGCTTTCGGTAC
AAGAGCGAGATGCATGGAACACATGGATCGCTAAATGGCGCCAATTCGAAGCGGACGCCCAAAACCTTCCCGGAGGTTAC
ACTGTGCAACTACGATGGACCCGCCGTCATCCGGTGCAGTTTGTTCCAAACTAACTTGGACAGCCCACATTCCCATCAGC
TGGTCGTGCGCAAGGACGATCGGGATGTGTGCGATCCGCATGATTTGCACGTGTCCAAGGAGCGCGGCTATGTGGCGCAA
TTTATCAACATGGGCATCATACACACCGCCAAGAAGTACATATTCGAGGAACTGTGCAAGAAGAAGCAGGATCGCCTGGT
CTTTCAGATGAACCGCCGCGAGTTGTCCCACAAACAGCTACAGGAACTGCATCAGGAGACAGAGCGTGAGGCCAAGGACA
TGAACTTGAACCAGGTGCGGCTCTGCTTTGAGGCCTTTAAAATTGAGGACAACGGCGCATGGGTTCCACTTGCACCGCCT
GTATACAGCAATGCAATCAATAACCGCAAGTCGGCACAAACTGGAGAGCTTCGCATCGTCCGCCTGAGCAAACCCACTGG
CGGGGTGATGGGCAACGATGAGCTTATTCTACTGGTGGAAAAGGTCAGCAAGAAGAACATTAAAGTGAGGTTCTTCGAGG
AGGATGAGGACGGGGAAACCGTGTGGGAGGCATACGCAAAGTTCCGCGAATCGGATGTACACCACCAATATGCCATTGTG
TGCCAGACGCCTCCGTACAAAGATAAGGACGTGGACCGCGAGGTCAACGTGTACATCGAGCTCATTCGTCCCTCCGACGA
TGAGCGCTCATTCCCGGCGCTGCCCTTCCGCTACAAGCCACGGAGCGTAATTGTGTCGAGGAAACGCCGACGAACCGGGT
CCTCTGCCAATAGCAGCAGTTCGGGAACAGAAAGCTCTAATAACTCGCTGGATCTGCCCAAAACGCTGGGCTTGGCGCAG
CCACCAAATGGCTTGCCAAACCTTTCACAGCATGATCAGACTATAAGTGAGGAGTTCGGACGCGAAAAGCATCTAAATGA
ATTTATTGCTTCCGAAGATTTCCGCAAACTTATCGAGCACAACTCTTCTGATCTCGAGAAGATCTGCCAGTTAGACATGG
GAGAGTTGCAGCACGATGGTCATAACCGGGCGGAAGTGCCATCGCATCGAAATCGTACAATTAAATGCTTGGATGACTTA
TTCGAAATTTACAAACAGGACCGCATATCGCCAATAAAAATCTCGCACCACAAAGTGGAGAAGTGGTTTATCGAGCATGC
TCTGAATAACTACAATAGAGACACGCTCCTGCACGAAGTGATCAGCCACAAAAAGGACAAACTGAAGCTGGCCATCCAGA
CGATACAGGTGATGAACTACTTCAATCTGAAAGATGTGGTCAATAGCACTTTGAATGCGGACGGTGATAGTGCCCTGCAT
GTGGCGTGCCAGCAAGACCGAGCGCACTACATACGACCTTTGCTGGGTATGGGATGCAATCCAAATCTGAAGAATAATGC
CGGAAATACCCCACTGCATGTGGCCGTCAAGGAGGAGCACTTAAGCTGCGTGGAAAGCTTCCTTAATGGAGTGCCAACCG
TACAATTGGACCTCTCGCTAACGAACGACGATGGTCTGACGCCTTTGCACATGGCCATTCGACAGAACAAGTACGATGTG
GCCAAGAAACTGATCAGCTATGATCGGACCTCGATTAGCGTGGCCAACACAATGGATGGTAATAATGCACTCCACATGGC
AGTTCTGGAGCAAAGTGTGGAGCTATTGGTGCTCATTCTGGATGCCCAAAATGAAAACCTTACCGACATCCTGCAGGCAC
AAAATGCAGCCGGCCATACTCCCTTGGAATTGGCCGAACGCAAGGCAAATGACCGGGTGGTCCAGCTGCTGAAGAATGTG
TATCCGGAGAAGGGAGAACTGGCCATGACCTGGATTCCATGTAAGGTCAAGGAGGAGATCGATTCATCGTCGGACGAAAG
TAGCGATGCTGGTCAGCTGGAGATCAAGTCCGAGGAGATGGACATCGAAACAAAGGACGAGGATTCCGTGGAGTTGGACC
TAAGTAGTGGTCCAAGAAGACAGAAAGATGAATCCAGTAGAGACACCGAAATGGACAACAACAAATTGCAGTTGCTGCTC
AAAAACAAATTCATTTACGACCGGCTCTGTTCGCTGCTGAATCAGCCTTTGGGACATGGGTCCGATCCCCAAGATCGGAA
ATGGATGCAACTAGCCCGCCAGACGCATCTGAAGCAGTTCGCCTTTATATGGCTGGGCGCGGAGGATCTGTTGGATCACG
TGAAAAGAAAAGGAGCCTCTGTAGAGTTTTCCACATTTGCTCGTGCCCTGCAGGCAGTGGATCCACAGGCTTACGCCCTA
CTGGTTAACCCAACTTGATTATGTATTGAATGTTGATCAATAAAGTACCTTAGTTTTAC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0089339
3351
FBtr0089340
3042
FBtr0089341
2722
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0088375
971
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0088973
971
FBpp0088971
971
FBpp0088972
859
Comments

minor (3.5kb) transcript (GB:AF186073)

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG11992-RA
Secondary FlyBase IDs
  • FBtr0006723
References (3)