Open Close
General Information
Symbol
Dmel\dnr1-RB
Species
D. melanogaster
Annotation Symbol
CG12489-RB
FlyBase ID
FBtr0330229
Feature type
Associated gene
Evidence Rank
Length (nt)
3553
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 29 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      ATTCTATGTTTGGCAGCTCTGTGTTAAACACCGAATACTCTGAAACAAAAACAACAAGGATATCCGTGAAATCGCCGGGA
      AAAAAATATATCACGAAGTAATATTTTTATTTTTGCACAAAAATTTACCACTGCATACAAACTACAACGCGTTTTGCAAC
      AATAAACAAGCTAAAATCAAATTGGAGAAACCAACAACTGTAGCAACAATCAAAAAAGTTTACGTGAAATTCGAGCGTAA
      AAATGTGTACAAAATTCCAAAAGTGCAAATATATTTAAATTACCCCGCAGTGCTCAACGTTCAAAGTTAACAAACAGAAA
      ACAAGTCACATAATTGCAAATAAAATTAAAACAGTTACCCAGACTGAAGCAAAAAACGCGGTGCAACCTGTAGCGCTTCA
      ATTCCGATTGTGATTTTGAATACACACCACGGCTTTTGTGCAAACAAGCCGGAAGCAAATCCCAAATGCAATTGTTTTGA
      ACCGCAGCTGAGCGGAGCTTTTACCTGTTGGACAAGAAATCAAACGGCAGCGTTAGCACAGAAAAGGCCAAAAGATGTGG
      TGCATTGTCAACCTGCCCAACGGCACCCAACAAGCCGTCAAGTGGGATCCCAAAGCCAATGGTCAGGAGTGTCTGGAGAA
      GGTCTGTCGCGCAATGAACATCATCTGCGAGATGGAGTACTTCGGCCTGGAGCACTGGACGCCCAACCAGAAGGAGTCGC
      AGACGCGCCAGTGGATCAATCTGCGCAATCGGCTATCCGGCGACAGTGGCAGCAGCGGCAGCGGCATCCAGCTGATGCTG
      GCGCTGCGGGTCAAGTTCTGGGTGCCGGTGCACTTCATCCTGCAGGAGAGCGTGCGTAATTTGTTCTACATGCAGGCCAG
      GCGGGATCTGCTCGAGGGACGGCTCACTGCGCCGGACTGGAGTGGAGCGGCCAAGTTGGCGGCGCTGCTCTGCCAGGCGG
      ATGGTCTGCGATTCAATGAGTCGTCGCTGAAGGCCGACTGCCCGATGCGAATGAGGCGGGAGTTGGCGCAACAGCAGCAG
      CAGCAACAGCAGCAGGCGCAGCAGCATAGGTTGGAGCAGCAGCGCAAGGAGAAGGAGCATGTGCTGAGCTTCAAGAAGCG
      CCGCCTGTCCAAGCAGAAGTCCATGGAGCACATCGAGGTCTGTACGCTGCCAGCGGCAAGCACCACCAGCTGCAGTCTCC
      AGCCCTCGCCATCCGCATCCGCCTCAGCATCTGCATCCGCCTCAGCATCTGCATCCGCCTCCACATCCGCCTGCTCGCAA
      ACCCACTCGAACAGCAGCTCGAGCAGCCCCAGCAACAGCAGCAGCCAGACGGGCCTGGACGAGCGACTGGCCAGCAATCC
      GCTCCGCGTCTACGAGGAGTACTTCATGCAGCCGAGCTGCGAGGGTGAGCCACCGGCGGACTATCTGCGCCAAATAGCCG
      TGGAGCACGGCAAGCTGGCCAAGCTGCAGATGAGCCTCAAGACGGCCAAGTACTGGCTGCTCAAGTCCATCCAGGATCTC
      GAAGGCTACGGCGAGGAGCTCTTTAGCGGCGTGACCACCAACGAGAGTGCCACGCGCTGCGACATTGCGGTGGGCGCCCA
      TGGCATCACCGTCTGCCGGGGGGGCGAGAAACAGAGCATCCCCTTTGGCGCCATCGCTGCGGCCAAGTCGCTGCGTCGCA
      CTTTCAAGTTGGAGTACGTGGATGACCACAACGATCGCAAGGAGCTGGAGATCAAGCTGCCCAAGCAGCCGATCGCCGCG
      GGCCTGTACCGCTCCATCACGGAGCGCCACGCCTTCTACGTGTGCGACAAGGTGCGCGGAGTGGTGACCAATCAGTTTAC
      CCGGGATCTCAAGGGCACCATCGCCTCCATGTTCATGGAGAATACGGAGCTGGGCAAGCGCTATGTCTTCGACATTCAGC
      ACACGTGTCGCGAGGTGCACGACCAGGCGAGGAGGACTCTCCACGAGCGGGGCGGCGATCTGGTGGCGGAGGGAGCCGAG
      GGATGCTCTGCTGTCGCTGGAGGATTGGGCGCCTCTGCCGTCGGCGAGCCGGGCGTCAGCCCATGGGCCATGGCCCTGAC
      GACTGGTGCCGGCGGCTCCATGGCCGGCAAGATAGATTTGGCCATACGCGAGAAGGAGGCGCGTGAGGCGGCGATTGAGC
      GTTGCGTGGACACGCGCATCTCGGAGGCCATGCAGTGCAAGATCTGCATGGACCGCGCCATCAACACAGTGTTCAATCCG
      TGCTGTCACGTCATCGCCTGCGCCCAGTGCGCTGCACGATGCAGCAACTGTCCCAACTGTCGGGTGAAGATCACCAGCGT
      GGTCAAAATCTATCTGCCGCCGGAGCTGCGCACCAGCCAAACCGGCAGCGGCGCCACAACCACCAGCAGCAGCAGCATCA
      TGGGCGACGGCCAGGTGGAGGAGCAGCTGCTCCAACAGCAGCTGGACGAGATCTCGGCGGCACCCGCATCCCTCGAGGCG
      GGCGCAGATGCAGGAGTGGGAGTTGGCGGCATGGCAGTGGGAGCAGGAGCAGGAGCAGGAGCAACCGGACCTGGCGGACA
      GCCGAAGGTTACGACGGCCGCCTAGAATTGGTTGTGCTCGCTGCTGTTCCGGCTGATGGAATGGGTGTGCGTGCCGATTG
      TCTGAGAACCAACATGATTCACTAGTGCTCTATGACCACAACCTAAAAGGGGAACAAACCGACGAGGCAAGCAAGCAACT
      GGCAGCGTGCAACATGCCACGTGCAACGTGCAACATGTCACGTGCAACGTGGGTTTGAAATCGATTCGAAGCGGCGTAGT
      CAGTCTTTCAAACAATCTTAGCTCTATCTTTACTCAAGTATTCTAGCGACATAAGCAACTGAAACTTTAACTCTAACTCT
      AGCTGTAACTCTAATCTACAGAGTAGCCATATACACGATATATATATATACCTAATATATATATATATATACATATATTT
      ACTATTTATAGATGTACGAACTTCGAGAAAGTGCTATTTAAACTCGTCTAAGACTTCACTGCATAGCCTATGCCTAGAAT
      CTATAACTGCAGATTGTTTCATATTCATATACACACTGTATACTGTATACACATAGATATATTTACGATCGTTATAGATC
      AGCGATACCTTATACGATGTAGCCCTTGAATGTACAACATAGTTACTTACTAAATGTTAGCAATTTTACCAACTAAAACT
      CGAGATGTATTTATTAACGCCTAAACTCTTTAGTATTCCACCCTACCCAAAGGAACCTATATAAGAAGCCCCCCAAATTC
      TCATATATCTAACCATGGATACCTATTAAAAAACTATATGTTATAGCGTGTGTATATATAGGACAAGCGTACAATAATCG
      CAAACCCAAGGAGCAAAGTAGTACTAAGTACCTGCAAATCAAACAGAAAAACATAAACCGAAACTGAAACAGAACACGAA
      ACACGAAAAGTATCTCTGCAGCGGATATTACATAGTCAATAGTAAATGTTAACAATGTTATACTATATATACATAGATCT
      ATATATATATATAAATATATATATATATATATA
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0071837
      3194
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0303262
      696
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0071748
      676
      Comments

      Extended 3' UTR based on RNA-Seq data.

      Stop-codon suppression (UAG) postulated; reflected in aa sequence of predicted polypeptide.

      Transcriptional initiation is supported by short-capped RNA data (FBrf0209722).

      translation_exception: stop_codon_readthrough

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      dnr1-RB
      Secondary FlyBase IDs
        References (0)