A TI{KozakGAL4} DNA cassette has been inserted into baf, replacing the coding sequence (coordinates of deleted sequence are 2L:8029564..8030062 , release 6 genome). This results in a simultaneous knock-out of baf plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of baf (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of CG7367 and is not predicted to gene trap this gene. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: ATTGAAATCTAGCTAAGCATTGG and GCAAATGCTTAGCTAGCATTGGG.