A TI{KozakGAL4} DNA cassette has been inserted into Eglp3, replacing the coding sequence (coordinates of deleted sequence are 2R:23605762..23606637 , release 6 genome). This results in a simultaneous knock-out of Eglp3 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Eglp3 (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of a coding intron of Eglp2. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: CTTCTGTTGCGACATGCTGACGG and CGGAGAGGTTATAGTGCAATAGG.