CTGGTTCTGACGCAGCTGCTGCCCCGCTGGGTGGATCTGGAAAATGTGGTCCGTGGTGAAGTCGAGGCGCGCTACATACT CAAAAGAGCCGCGGATCACCTGGCGAACTTGAGGTCTGGCGGAGATTCCGGGGCGGAGGAAACCGGATATCTGGTAGGTG CGCTGGTGGACAGGAACTGGGAACGCATTCACACAGGGCACTTCAGCCAGGTTCCCTGTGGGTTCATC
Clones isolated by an inverse-PCR screen (SLIP) using a mixture of the GH, LD, LP, and SD cDNA libraries.
Adult heads were collected from an isogenic y; cn bw sp (iso-1) strain.
These clones have been isolated a directed screening process called SLIP (Self-Ligation of Inverse PCR Products). Clones isolated from this screen have been PCR-amplified using a mixture of 4 different plasmid cDNA libraries as template. These include the GH, LD, LP, and SD cDNA libraries.