ATCAGAGGGCGACGCCTCCGCATCGGGTATATCTGCTCACCCCTGTACGTACATCAAATTTATGAGTGGCTTCCTTTGAG CGACCACCAAAATAAACTTATGAACCGTGGTATGGATGT
Cloned cDNAs prepared from RNA isolated from mixed stages, embryonic through adult.
A minilibrary was made by cloning products derived from ORESTES PCR (U.S.Letters Patent application No. 196,716 - Ludwig Institute for Cancer Research) profiles into the pUC18 vector. Reverse transcription of whole animal mRNA and cDNA amplification were performed under low stringency conditions.