Reference Report
| Reference | |||
|---|---|---|---|
| Citation | Cook, K., Garton, R., Brown, A., Ward, M., Deal, J., Kaufman, T., Cook, K. (2010.9.17). Generating Y-linked X chromosome duplications for region 14F to 16C. (Export to RIS) | ||
| FlyBase ID | FBrf0211864 | ||
| Publication Type | Personal communication to FlyBase | ||
| PubMed ID | |||
| PubMed Abstract | |||
| Text of Personal Communication |
Generating Y-linked X chromosome duplications for region 14F to 16C
Kim Cook, Russell Garton, Adam Brown, Megan Ward, Jennifer Deal, Megan Deal, Thom Kaufman & Kevin Cook Bloomington Drosophila Stock Center Indiana University We have generated a set of Y-linked duplications of X chromosomal segments by irradiating an attached-XY with an inversion in the X chromosome. The progenitor C(1;Y)N12, In(1)BSC19, P{w+mC=3'.RS5+3.3'}BSC19 w1118, BS chromosome has the following form: 1Lt to 1B5|16C1 to 1B5|16C1 to X heterochromatin breakpoint distal of bb|YS to YL|BS In(1)BSC19 is described in FBab0046085 and its construction was described in FBrf0209647. P{w+mC=3'.RS5+3.3'}BSC19 is associated with the distal inversion breakpoint. Large irradiation-induced deletions within this progenitor chromosome with one breakpoint within the inversion near the distal inversion breakpoint and one breakpoint in X heterochromatin or basal X euchromatin produce Dp(1;Y) chromosomes of the form: 1Lt to 1B5|16C1 to medial breakpoint|basal X breakpoint to X het breakpoint distal of bb|YS to YL|BS The Dp(1;Y) chromosomes share the same distal 1Lt to 1B5 segment containing the yellow (y) gene. The medial segments of these Dp(1;Y) chromosomes share a common end derived from the inversion breakpoint at 16C1 , but they extend different distances distally on the standard X map. The Dp(1;Y) chromosomes carry segments of different sizes from the base of the X. The breakpoints typically lie in basal X heterochromatin, but they may lie in basal euchromatin. Dp(1;Y) chromosomes with breakpoints in YS cannot be established in stock, because deletion of YS male fertility genes renders males sterile. The BS-marked tip of YL in C(1;Y)N12 carries a portion of the base of the X distal to bb. From Comparative Genome Hybridization microarrays of chromosomes derived from C(1;Y)N12 performed by Eric Spana at Duke University, we determined that the distal breakpoint of the basal X segment lies between Release 5 coordinate X:22228492 in fog and coordinate X:22384175 in stnA and that genes proximal to stnA are duplicated. We could not determine the proximalmost extent of this segment, but the microarrays indicated that the duplicated segment extends at least to coordinate X:22416503 in CG13865. We saw no evidence for a large duplicated segment encompassing the BarH1 and BarH2 genes in 16A, but the resolution of the microarrays is not high enough to exclude the possibility of a small duplicated segment from the region. We exposed C(1;Y)N12, In(1)BSC19, P{w+mC=3'.RS5+3.3'}BSC19 w1118, BS males lacking a free Y chromosome to ~4500 rads in a 137Cs irradiator and mated them to winscy females. Dp(1;Y) chromosomes were recovered in y+ w+ BS males. Stocks were established by crossing these males to winscy females. 14 independent Dp(1;Y) chromosomes were established in stocks from approximately 262,000 progeny screened. We maintained the isogenic background of the DrosDel transposon collection in generating the progenitor C(1;Y)N12, In(1)BSC19 chromosome and in all the Dp(1;Y) screen crosses. Only the proximal regions of the X chromosome and the Y chromosome of C(1;Y)N12 were introduced from a different genetic background. Fourth chromosomes were not tracked. The distal 1Lt to 1B5 segment shared by all these duplications extends proximally to Release 5 coordinate X:387562, the insertion site of P{RS3)CB-5805-3 used in the construction of In(1)BSC19. The distal extents of the basal duplicated segments were determined by the positions of the proximal irradiation-induced breaks. We did not map these breakpoints. We cannot exclude the possibility that genes from the base of the X chromosome are present in the basal duplicated segments. On the standard X map, the proximal end of all the duplicated medial segments lies at Release 5 coordinate X :17576847, the insertion site of P{RS5}CG325565-HA-1561 used in the construction of In(1)BSC19. The distal extents of the medial segments were determined by the positions of the distal irradiation-induced breaks. We mapped these breakpoints to ~10 gene intervals defined by PCR primers using the following approach. Males carrying the new Dp(1;Y) chromosomes were crossed to females carrying a transposable element insertion positioned distal to P{RS5}CG325565-HA-1561. Primers flanking the insertions sites of the transposable elements were used to amplify fragments from DNA isolated from male progeny. With short extension times, fragments are amplified only if the site of the transposable element insertion is present in the Dp(1;Y) chromosome. Breakpoints were mapped to successively smaller intervals in iterative rounds of crosses and PCR amplifications. The following transposable elements and primer pairs were used in mapping: Insertion: P{EPgy2}EY08038 Forward primer: GTGCTGCTGTTTCGTTACCCG (X:16427074..16427094) Reverse primer: GATGCCCGCTGTTATCCTGGCG (X:16427494..16427473) Insertion: P{EPgy2}mbtEY08341 Forward primer: GAAGTCTATGTTGAGAGAGAAACGG (X:16504426..16504450) Reverse primer: GGATGGACAAATCGAGATGCGC (X:16504885..16504906) Insertion: PBac{RB}re02423 Forward primer: GGATAACTTGATGGCGATACTAATGC (X:16549682..16549707) Reverse primer: CTTTAGTACCTGTCACTCGAAAACCG (X:16550363..16550388) Insertion: P{EPgy2}AxsEY00887 Forward primer: CCTGACAGTGTCTTAGCTTGGCC (X:16577115..16577137) Reverse primer: CGTCACGCGCCACGCAGCTGGG (X:16577773..16577794) Insertion: PBac{WH}CG18358f05802 Forward primer: CCAATCAATCGCGCACACACCCACG (X:16609614..16609638) Reverse primer: CAACGAATGCGTACAGCTTTAACC (X:16610367..16610390) Insertion: P{SUPor-P}mRpL22KG10050 Forward primer: CGCGACGCGCTGTTGAGAACG (X:16677554..16677574) Reverse primer: CAAGTGGATTAGAGGATTGCAGC (X:16678418..16678440) Insertion: P{SUPor-P}CG4768KG09304 Forward primer: GAACATAGTGATTCGTGACTGGTTCG (X:16685900..16685925) Reverse primer: CCCTTCCAAGTTACGGGTTCC (X:16686531..16686551) Insertion: P{SUPor-P}KG04053 Forward primer: CAAACTGCTTAACTTCACGAATATGC (X:16729993..16730018) Reverse primer: CAGACAGAAGGTGGAAAGACAGGC (X:16730511..16730534) Insertion: P{EP}EP1337 Forward primer: CGCGCCCCGTTATATTACATTATGC (X:16837341..16837365) Reverse primer: CTCTGCTAAATTGCTAAGCTGATTTCCC (X:16837767..16837740) Insertion: PBac{WH}CG8945f08057 Forward primer: GGGAGTACTCACCCGACGAGC (X:16980041..16980061) Reverse primer: GGCCAAATACACGTAGGAAGAAGCG (X:16980768..16980744) Insertion: Mi{ET1}CG4991MB03239 Forward primer: CCGACCGGAGAAGTTTAGCACC (X:16997281..16997302) Reverse primer: GATTGAGCTTGGGAACGACCAGC (X:16997887..16997909) Insertion: P{EPgy2}bazEY09846 Forward primer: GCTCTTCCTATGAATTTCGTCGAGCTAATCC (X:17070780..17070810) Reverse primer: GTTAGTTAGCTAGGCATTTATTCCGC (X:17071658..17071633) Insertion: Mi{ET1}CG5172MB05660 Forward primer: GATGCTGACTTGTGTTCCATGGC (X:17116553..17116575) Reverse primer: GACACCACTATCCACTGCTCAACC (X:17117104..17117081) Insertion: P{XP}Fimd02114 Forward primer: GCTCCACGTTGAGAATATCGGCC (X:17185337..17185359) Reverse primer: CGCGTTTTCTAAAGGTGTTCGTCTGCC (X:17185864..17185838) Insertion: PBac{WH}CG8557f03948 Forward primer: CGCTGATTATGAGGATGGCACGC (X:17370704..17370726) Reverse primer: GCACCTTGTCTAATTTATGCCTCG (X:17371436..17371413) Insertion: PBac{RB}X11Le03317 Forward primer: CTTGTACTATCCGTTCGAATGTTGC (X:17493278..17493302) Reverse primer: GCACTACTCCTTCAGCAACTCG (X:17493693..17493672) Insertion: P{SUPor-P}CG32556KG01967 Forward primer: GCTACGTGGTCACATAGATACACC (X:17575254..17575277) Reverse primer: GTGCACACTCTCCCGAAGGCG (X:17575754..17575734) The Dp(1;Y) chromosomes carry the following medial segments (Release 5 coordinates and predicted cytologies): Dp(1;Y)BSC200 X:16427074..16504426;17576847 (14E1-14F2;16C1) Dp(1;Y)BSC201 X:16577115..16609614;17576847 (15A1-15A3;16C1) Dp(1;Y)BSC202 X:16729993..16837341;17576847 (15A11-15C4;16C1) Dp(1;Y)BSC203 X:16837341..16980041;17576847 (15C4-15E1;16C1) Dp(1;Y)BSC204 X:16837341..16980041;17576847 (15C4-15E1;16C1) Dp(1;Y)BSC205 X:16837341..16980041;17576847 (15C4-15E1;16C1) Dp(1;Y)BSC206 X:16997281..17070780;17576847 (15E3-15F1;16C1) Dp(1;Y)BSC207 X:17116553..17185337;17576847 (15F4-15F9;16C1) Dp(1;Y)BSC208 X:17185337..17370704;17576847 (15F9-16B1;16C1) Dp(1;Y)BSC209 X:17185337..17370704;17576847 (15F9-16B1;16C1) Dp(1;Y)BSC210 X:17370704..17493278;17576847 (16B1-16B7;16C1) Dp(1;Y)BSC211 X:17493278..17575254;17576847 (16B7-16C1;16C1) Dp(1;Y)BSC212 X:17493278..17575254;17576847 (16B7-16C1;16C1) Dp(1;Y)BSC213 X:17493278..17575254;17576847 (16B7-16C1;16C1) |
||
| DOI | |||
| Related Publication(s) | |||
Recent Updates
|
|||
| Description |
What does this section display?
This section contains items that were added to this record for each release.
It currently only tracks new links between this FlyBase report and other
FlyBase data classes (e.g. genes, references, stocks) or controlled
vocabulary terms (e.g. GO, anatomy terms).
What does this section not display?
This section does not currently display links that were removed or gene model changes.
|
||
| Update Feed |
Click the icon below to subscribe to this FlyBase record and receive updates automatically through your
feed reader.
|
||
| FB2013_03 | |||
| FB2013_02 | |||
| All updates | Click here to see a list of all updates to this record from FB2010_08 and on. | ||
Associated Information
|
|||
| Comments | |||
| Associated Files | |||
Other Information
|
|||
| Secondary IDs | |||
| Language of Publication | English | ||
| Additional Languages of Abstract | |||
| Also Published As | |||
Parent Publication
|
|||
| Publication Type | |||
| Abbreviation | |||
| Title | |||
| ISBN/ISSN | |||
Data from Reference
|
|||
Aberrations (15)
|
|||
Alleles (1)
|
|||
Insertions (1)
|
|||
Recent Updates