Generating Dp(1;Y)BSC346
Kim Cook, Russell Garton, Adam Brown, Jennifer Deal, Megan Deal, Thom Kaufman & Kevin Cook
Bloomington Drosophila Stock Center
Indiana University
We isolated Dp(1;Y)BSC346 in a screen identical to the screen described in http://flybase.org/reports/FBrf0211862.html.  Our objective was to isolate a duplicated segment larger than those isolated from the previous screen.  11 independent Dp(1;Y) chromosomes were established in stocks from approximately 27,000 progeny screened, but only Dp(1;Y)BSC346 was judged large enough to retain. 
The following transposable elements and primer pairs were used in mapping in addition to those listed in the previous report:
Insertion: PBac{WH}Atx-1f01201
Forward primer: GCAGGTGCAGCCGGGTCATCC ( X:6717733..6717753 )
Reverse primer: CCATTAGAATGCTTGACAGGAGG ( X:6718403..6718425 )
Insertion: P{EPgy2}EY03050
Forward primer: GGTCCGCCTATCCTTTGTCCC ( X:6777690..6777710 )
Reverse primer: GATAGTAGCAGCGTTGCCAGGC ( X:6778164..6778185 )
Insertion: PBac{WH}ogref07788
Forward primer: CGTGTACAAGGGGTTTTCACG ( X:6875585..6875605 )
Reverse primer: CAAGTTATTCCGTACCTTTTCGTAGGCC ( X:6876203..6876230 )
Insertion: P{XP}CG14427d06860
Forward primer: GTCACCCACATTCCGGAGGC ( X:6935287..6935306 )
Reverse primer: GGCCCCTGACCTTTGACCCGC ( X:6935833..6935853 )
Dp(1;Y)BSC346 carries the medial segment  X:6717733..6777690 ;8087225 (Release 5 coordinates) with predicted cytological breakpoints 6D3-6E2;7D18.