A TI{KozakGAL4} DNA cassette has been inserted into COX7CL, replacing the coding sequence (coordinates of deleted sequence are 2R:10050445..10050869 , release 6 genome). This results in a simultaneous knock-out of COX7CL plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of COX7CL (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of the sel 3' UTR. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TTTAATCCGTTTGTTGAGACGGG and TAATAAAAATACATTGCACATGG.