A TI{KozakGAL4} DNA cassette has been inserted into CG4960, replacing the coding sequence (coordinates of deleted sequence are 3R:25786635..25787286 , release 6 genome). This results in a simultaneous knock-out of CG4960 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG4960 (predicted to gene trap all annotated transcripts of the gene). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: ACTGGCATTTAGAAAGCCGGCGG and TGCGAAATGTATCCGATACGAGG.