TTTTTTTTTTTTTTTTTTTTTTTTTCAAAGGTACCAAACGTTTTATTATAAAAACAAAATGGTCTACACAAACTAAACGA AATATGCCATATACAAGTAATTCGAACTTAGGGCTAAAACTAAAGCTAA
Cloned cDNAs prepared from polyadenylated RNA isolated from pupal salivary glands. The strain used was not the iso-1 sequenced strain.
500 pairs of hand-dissected salivary glands were collected from mixed stage animals (16, 18, 20, 22, and 24 hrs after puparium formation at 18oC).
Used to construct an oligo-dT-primed directional cDNA library (Vector: pSPORT1; Site_1: NotI; Site_2: Sal).