CCAGCAAGATGAAAATTGGCTTGTGCGCATTCAGCGGGTACAAAATCTACCCCGGTCATGGCAAGACCATGGTCAAGATC GATGGCAAGTCGTTCACCTTCCTGGACAAGAAGTGCGAGCGCTCCTACCTGATGAAGCGCAATCCCCGCAAGGTTACGTG GACCGTGCTGTACCGCCGGAAGCACCGCAAGGGAATCGAGGAGGAGGCCTCCAAGAAGCGCACCCGCCGCACCCAGAAGC TCCAGCCCCCCCTC
Cloned cDNAs prepared from polyadenylated RNA isolated from stage S1-S6 ovaries.
Ovaries at stage 1-6 of oogenesis were collected from a non-isogenic Oregon R strain P2 population cage.
RNA from ovaries was poly(A)+ selected once (provided by A. Spradling). cDNA made using Stratagene ZAP-cDNA synthesis kit; oligo(dT) primed with XhoI site at end of primer for first strand synthesis; EcoRI adapter on 5' ends of clones; size fractionated on Sephacryl S-500--approximately 1-6kb. For clones GM12101 and higher, cDNA directionally cloned into EcoRI/XhoI-digested pOT2 plasmid.