Comment: 0-22 hr AEL
ATTTCGGGCGCTAAAGAATTGTTTACTGCCCCTCGATAGTGGATCGTAAGGACCCGGCTCCATTAAGTTCGAGTGCATTT GCGGGTCGGCGGCGTAAAAGACGCGCAAATCTAGCAGGGAATTTGCCCAATTCGCTGCTTCGGGTGAAATTTCAATGAAC TGAGANAACAAAGACAGACACACACACAAACACACGCACAGGGTCACAGACACAGTGCTTGTGCAGCAGTGTAGTAAGAA GCAGA
Cloned cDNAs prepared from polyadenylated RNA isolated from 0-22-hour embryos.
Embryos at 0-22 hr AEL were collected from an isogenic y; cn bw sp (iso-1) strain.
RNA was poly(A)+ selected twice. cDNA made using Stratagene ZAP-cDNA synthesis kit; oligo(dT) primed with XhoI site at end of primer for first strand synthesis; EcoRI adapter on 5' ends of clones; size fractionated on Sephacryl S-500--approximately 1-6kb. For clones LD21101 and higher, cDNA directionally cloned into EcoRI/XhoI-digested pOT2 plasmid.