Comment: 3-7d old
GATCTGTGGATTGTAGCTCATCCCCTGCGTTTGCTGCATATATTTCTGCCAGTACTATTCGGAGTTGTGTTTGCCATCTT TTCCTATATCTA
Sequence of 3' ends of cDNAs prepared from total RNA from adult females.
Total RNA was isolated and double-stranded cDNA was prepared using an oligo-dT primer for first-strand synthesis. Preparations were digested separately with Mbo I, Nla III and Tai I, and 3' fragments recovered. The 3' fragments produced by each restriction enzyme were pooled before sequencing.