Open Close
General Information
Symbol
Dmel\SmydA-4-RB
Species
D. melanogaster
Annotation Symbol
CG11160-RB
FlyBase ID
FBtr0073391
Feature type
Associated gene
Evidence Rank
Length (nt)
2433
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 17 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        ACAGTTGCAATTTGTGCCTCGCGGTTCGAACAACGCGTGGCCAGAGTTTTTATTTATATACAAATATATATACACACATA
        TATATATATATATATTTTTTTTTTATTTGTTGTTATCTTCGATTCTTGAATTCCATTTCCCATTTGGTTGTTTGTTTGGT
        TTTCCCAGTGCAATCTGCTGACACATTTATCCGACGCGATTTACACGGCGCAATTAATTGACGAGTTGTTAAACATATCT
        ATTAAATGCGAACGGCCTTTTGAATAACTCGTGTGCACCGCGTTAAAATTATCAATTAAAATCAATTAACAAGCTGTGCC
        GCGGAAATAAAATAAAATCAAATTTAAATACAAATAAAAGCGATGCCGGGAAGAAAAAAAAACCACCACAAAAACAACAA
        CAACAGCAGAGCCAGACACCAGCGGGGTGGTCAACAGTCGAAGGATAAGCAGGAGCAGCAGGACAAGGAGCAGAGTCCCT
        CGCCAACGGAGGAGAAGGAGTTACCATATCGCGTAGAACACTCCGATATATATGGACGATATTTGGTGGCCAATCGCCAA
        CTGGAGGCGGGCGAAACGCTGATCCGCGAGGAGCCACTGGCCATTGGGCCGTGTGTGAGCGGTGATCCCGTGTGCCTGGG
        TTGCTATCACCCGGTGTCCCTTAAGGCGGATCAATATCGTTGTCCCGGCTGCGCCTGGCCACTCTGCGGCAGCACTTGCG
        CTGGCCTCAAACATCGACATGGTCACACTGAAACGGAGTGCCAACTGTACGCGGAACGACGGGCGGTCGCCGGCGAACTG
        CTGACGGAACGCGCCGGTCCGGCGGAAGTGCGTGACCTTTACGAACTGGTGATGATCGTTCGCATACTCCTCCTGCGCCA
        GCACGATCCGGAGCAGTTCGCTCTGATCGCCCGCATGGAATCGCATACGGAGGAGCGACGACAGAACGCGGTGCTGTGGC
        GCCACTACGAGGAGAAGGTGGTGCAGCGACTGCGCGTCACCTGGCAGCTGGAGGACCTCGAGGCGGAACAGGTGCACGAG
        GTGTGCGGCATACTGGACGTCAATTGTTTCGAGATCGGCCAGAATGGCGCCAAGGCGCGGACGCTATATCCGAGCGCCTT
        CCTGCTCGCGCACGACTGCACACCGAACACGGCGCACACGGACGACCCGAGCTCCTTCGAGATCCTGCTGCGCACCTCGC
        GGCGCGTGCGCGAGCGGGAAGCGCTGACGCTCAGCTATGCGTACACGCTGCAGGGCACACTCAAGCGGCGCGCCTTCATG
        CACGAGGGCAAGCTCTTCTGGTGCTGCTGCCGGCGCTGCTCCGATCCCCGCGAGCTGGGCACCGACTGCAGCGCCCTCGT
        GTGCGCCACCTGTCGGACGGGATCGGTGCGAGCGGTGGATCCACTGCAGCAGACCGGCGACTGGGCCTGCGACCGTTGCG
        CCCATAAAATGGGAGCCACGGAAGTGGAGCGCCAGTTGGATCGTATCAACAACGACCTGGAGGACATTGATGTCCACGAT
        ATTCCAGGACTGGAGAACTTTCTCCTTAGGTGCGTCTGCATTCACGGGTCATAGGCATACTTCTAATATACATACATATA
        TTTAAAAATATCTTCACATACATATCTAAATGCTTTAACTAATTTGAAGAATCATTTTAGCCCAATTCGGTCGATCGATC
        AGTAACAAAATGGAAAAAAAAATATGGCTACCTCTAATGCGAGTGCGACAGTTTTAATATTTTGCATTATAATTCTGAAT
        TATTCTTTCCTTTCATTTTATTATTTATTCATCGGTTTACGCATGAACAAGACTTAAAGCAGAAGGATAATAATATATCT
        TACCACTTTCCTTTTGTTTCGTGACTTCCAATCGATCATTGTCCTGCAGATATCGGGATGTCCTGCGACCGAATCACTAC
        CTCCTGCTCTCGGCCAAATATTCCTTGTGCCAGATTTACGGTCGAACTGAAGGATACTTACTGCCACAGATGTCCCCAGA
        GGACATTGCCCGCAAGGAGAGCTACTGCCGCGAGTTTCTGGAAATCGTAGATGTACTCGATCCGGGTCTGACCCGTCTGC
        GAGGACTCATCATGTACGAGCTGCATGCCCCCGTAATGGTTTTGGCTCAGTCGGCATTCCAGAGCGGACAGATCTCACGA
        CAGGAGTTCCAGCGGCGACTCAAAGAGGTCGTCAAGCTGCTCCAAGTCAGCAGGGATATCCTGCTAATGGAACCCGAAGG
        ATCTACGGAAAATGCAATGGGACAGGCTGCAGCCGATGCGCTAAGCAAAATGGGTTGCTAGTCAAAAGGGGCTCTTTAGA
        CTATTTGTAAATTAACTGAGTTTATTTTAACACCAAATGTATCTCAAAATTAAAATACCAGATAGTCCGGTATGGGTTAA
        TTAGAAAATATATATGATTTTCAAAGGAATAAC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0073390
        2093
        FBtr0331720
        2106
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0073247
        403
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0073246
        532
        FBpp0304109
        369
        Comments
        Based on cDNA(s) with retained intron; results in premature stop codon and/or downstream start; may or may not produce functional polypeptide.
        Transcript terminates at site supported by polyadenylated cDNA.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG11160-RB
        SmydA-4-RB
        Secondary FlyBase IDs
          References (2)