A TI{KozakGAL4} DNA cassette has been inserted into Naa30B, replacing the coding sequence (coordinates of deleted sequence are 3L:1471340..1472005 , release 6 genome). The upstream CRISPR cut site is within the ATG translation initiator codon and the insertion changes the ATG to AAA. This results in a simultaneous knock-out of Naa30B plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Naa30B (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of Ptp61F. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: AACGAAAACGTATACAATGGGGG and GCTTCTGATCGGTTTCGCATTGG.