A TI{KozakGAL4} DNA cassette has been inserted into CG32099, replacing the coding sequence (coordinates of deleted sequence are 3L:12149272..12150242 , release 6 genome). This results in a simultaneous knock-out of CG32099 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG32099 (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of Nrx-IV (CG32099 is nested within an intron of Nrx-IV). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TTCGCTATTGTGATGCAGTATGG and TACAAGCGATCATGATGTATAGG.