Comment: 0-22 hr AEL
TTTGGGTTTCTTTGGTGCGAGAAGACGGTTGGTGTTGTTATTTTTTTTTTTAGTTCGCTCCGCTGTTTTTAGGTGCTACG CGCTTTATGGCCCGCTCTTAATCTTATCGCAAATCAAATCAAACCGCGGCCAATGGAGCACCGTAATTTCACTTTTTGGC TAACGGTAACGGCACTTCCGCTCTCCGAATTCGATATTCAAACAGTCGCATTCCATCGAAAAGCGAAACAAGAAGTGGCC GCAAAAATGCCCGTGAAAACAGTGAATCGCCAGCAGAGCCAAACGCCCGCCCAACAACTGCAATTGCAGCAGCAGCGGGA CGTCGAGAATGGGCTCTATCCCACGATTCCGGCCGAGCGACGATCGCCCCCCTCGCGTCCGCAAACGCTGCGACAGGACA CCATCGATATGGAGGAAATACCGCTCAATCAGACGAACAGCCAGGAGCCAGAGGATCGGCGCAAAATGCACGAGATATTT GACAAGCACGACTCTGACAGAGATGGGCTGATCAACACGCACGAGCTG
Cloned cDNAs prepared from polyadenylated RNA isolated from 0-22-hr embryos.
For the RE cDNA library, embryos at 0-22 hr AEL were collected from an isogenic y; cn bw sp (iso-1) strain.
RNA was polyA+ selected twice (RNA made by L. Hong). cDNA was synthesized by priming with the oligo(dT) primer adapter (5'-GAGAGAGAGAGGATCCAATACTGGAGAGTTTTTTTTTTTTTTTTVN-3'). The first strand was synthesized in presence of trehalose, which increases the full-length cDNA synthesis (Carninci, P. et al. 1998. Proc. Natl. Acad. Sci. U.S.A. 95(2): 520-524; Carninci, P. et al. 1999. Methods Enzymol. 303: 19-44). Full-length cDNA was selected with the biotinylated cap-trapper (Carninci, P. et al. 1996. Genomics 37(3): 327-336). A linker was then ligated to the single-strand cDNA following the published protocol (Shibata, Y., et al. 2001. Biotechniques 30(6): 1250-1254). Subsequently, the cDNA was normalized by using RoT=1.0 as published (Carninci, P., et al. 2000. Genome Res. 10(10): 1617-1630). Second strand cDNA was primed with the (5'-AGAGAGAGAGCTCGAGCTCTAATAAGGTGACACTATAGAACCA-3') primer. After restriction digestion of the hemimethylated cDNA with BamHI and XhoI, the cDNA was cloned in the lambda FLC-I vector. Subsequently, the library was bulk-excised into pFLC-I plasmid as described (Carninci, P., et al. 2001. Genomics 77(1-2): 79-90). cDNAs were transformed into DH5-alpha TonA strain.