TCGCAGGTCGCTTTGTTTTTGACGCCTCGCATTTAAATTTAGCCGGAATGAGCTTTCGTTCGTCTCCGCAGGGAAAGCCA CACCCAATGACGGACTATCAGTCCATCCGGCCTTCCGAAGTGGAGCAGCTCTTCGAGAAGAAGTTCCACTATCAGAAGCC GAAAGGAAACAAATCCTGGCAGTTGCCGCCACCGGATCAGGCTCTCTTCAGTGAGTTCTACCAGTTCGAGGCGCTGCAGG GACTGCGCGAGCAGCTGAATGCGGTTTAAAAGCAAACTNCAATGGGACTATG
Cloned cDNAs prepared from polyadenylated RNA isolated from cultured cells; cell line used was not derived the iso-1 sequenced strain.
For the SD cDNA library, Schneider L2 cells were collected.
RNA was poly(A)+ selected once. oligo(dT) primed with XhoI site at end of primer for first strand synthesis; EcoRI adapter on 5' ends of clones; size fractionated on Sephacryl S-500--approximately 1-6kb. cDNA directionally cloned into EcoRI/XhoI-digested pOT2 plasmid. ~300,000 colonies were plated out and a mass plasmid DNA prep was done using Qiagen Plasmids containing the cDNA inserts were size selected on Sephacryl S-500 column in order to exclude plasmids with no insert. Early elutions were collected and transformed into DH5 alpha strain (Gibco/BRL).