GATAGCCATAACACATTTATAATATAGCGACACGAGGTCTGTTCAACTCATCAACATGCATATGTACGGGTACAAACTCC AGATCCACCAAAGTTACATTATAGATACGATTATAATACAAAGATTGTGGCCTCCACGAGAGACTGCTGCAACAAATTTT CAGGGCTTTCGATTTAGTTCAATTCGGGTCACAACAGAGCTTGAAGAGATTGAAGATCGGGGGCCTAATCCGCCATGTTC ACATTGGTCATGCGCATTTTGGCGAAGTCCTCGAATACAATATTATCGGCATCATCCTGGGAATAGCCCTTCACATT
Cloned cDNAs prepared from polyadenylated RNA isolated from adult heads.
Adult heads were collected from an isogenic y; cn bw sp (iso-1) strain.
RNA from adult heads was poly(A)+ selected once. Oligo(dT) primed with XhoI site at end of primer for first strand synthesis; EcoRI adapter on 5' ends of clones; size fractionated on Sephacryl S-500--approximately 1-6kb. cDNA directionally cloned into EcoRI/XhoI-digested Stratagene Uni-Zap XR vector, which allows in vivo excision and recircularization of pBluescript SK(+/-) plasmid.
The GH library is separate from the HL library. Since many of the HL clones were not full length and others lacked inserts, a new adult head library was made.