GCCGCCAGNCATGACATCATTGCCTGGGTGACCAAGAAGACCGGCCCACCAGCCAAGGATCTGACCAGCGTCGCTGATGC CGAGCAATTCCTTAAGGACAACGAGATCGCCATCATTGGATTCTTCAAGGACCTGGAATCGGAGGAGGCCAAGACCTTCA CCAAAGTCGCCAACGCCCTGGACTCGTTCGTCTTTGGTGTGAGCAGCAATGCCGATGTGATTGCCAAGTACGAGGCTAAG GACAATGGNNGTGGTTCTGTTCAAGCCCTTCGACGACAAGAAGTCCGTNTTCGAGGGTGAGCTGAACGAGG
Cloned cDNAs prepared from polyadenylated RNA isolated from embryonic rough ER, to enrich for mRNAs encoding secreted and transmembrane proteins; also enriched for rare cDNAs.
Rough endoplasmic reticulum (ER) was isolated from 8-16 hr AEL embryos from a non-isogenic Oregon R population cage to enrich for mRNA encoding secreted and membrane-associated proteins.
RNA from isolated endoplasmic reticulum as poly(A)+ selected twice. Note that only 70% of the cDNAs appear to be from secreted or membrane-associated proteins; the rest are cytoplasmic or nuclear proteins. Oligo(dT) primed with PstI site at end of primer for first strand synthesis; normalized to genomic DNA beads; KS complementary sequence put at 5' end of each cDNA HindIII/XmnI adapter on 5' ends of clones; cDNA directionally cloned into HindIII/PstI-digested pBluescript SK(+) vector.