Gene or accession: CG18436
Gene annotation error
Gene CG18436 has incorrect exon/intron structure.
Comments: This is a large gene encoding a large multidomain extracellular
protein which is the homolog of the moth Manduca sexta lacunin protein we
described recently (GenBank AF078161) (Nardi, J. B., R. Martos, K. K. O.
Walden, D. J. Lampe and H. M. Robertson. 1999. Expression of lacunin, a large
multidomain extracellular matrix protein, accompanies morphogenesis of
epithelial monolayers in Manduca sexta. Insect Biochemistry and Molecular
Biology 29, 883-897.)
By comparison with lacunin, I have three modifications to suggest to the
annotation. I should emphasize that the two protein products you annotate are
quite possible, indeed we found evidence for at least two alternative splicing
events in the moth lacunin, and the nematode homolog is also alternatively
spliced.
Nevertheless, with three minor changes, each of which is fully justifiable as
being more appropriate in terms of the introns involved, one can annotate it
to encode a good homolog of the moth protein (it has one fewer lagrin domains,
one more Kunitz domain, and one more immunoglobulin domain than the moth
protein, but these are minor differences given the alignability of the rest of
the protein, and the alternative splices in the moth involve addition of a
Kunitz domain anyway).
So, I would remove intron 4, which is not well predicted and is an open
reading frame \- this encodes part of a lagrin domain. I would adjust intron
10 from phase 0 to phase 1, which most of the other introns are, and uses a
better 5' splice site. I would then translate the rest of the cDNA as
annotated, except that I don't believe the last three exons are part of the
gene (the splice to them is very poor) and so would end the protein in intron
17, which aligns well with lacunin (for which we cloned many overlapping cDNAs
to complete \- 13kbp!)
Unfortunately when I try to send you my cDNA it says the 'URI is too long', so
here is my intron 10
gtaacatatacagcgggcgggtctcgacttgggggtcaccatggagtcgccgggctaactggttcttctcttgcgtaag
and I would end the cDNA barely into intron 17,
GTGGCCTCGCCTCCTCTGCATCCCAATGCGCTTTACAATGTTTAA