Refined mapping of Dp(1;Y)BSC267
Kim Cook, Russell Garton, Adam Brown, Megan Ward, Jennifer Deal, Megan Deal, Thom Kaufman & Kevin Cook
Bloomington Drosophila Stock Center
Indiana University
We were able to map the distal end of the duplicated medial segment of Dp(1;Y)BSC267 (FBab0046955) to a smaller interval than originally reported in http://flybase.org/reports/FBrf0212746.html. It lies between the following transposon insertions and their associated flanking primers:
Insertion: P{EPgy2}EY00885
Forward primer: GAGAGTGACGCTTTCTCGCGCGC ( X:13656333..13656355 )
Reverse primer: CATTATTATCATTGCGGGCAGCTGG ( X:13657098..13657122 )
Insertion: PBac{RB}jube03614
Forward primer: GTGTGACCGCCGCGGGTTACG ( X:13724330..13724350 )
Reverse primer: CAACGACATCACGCGCACC ( X:13725065..13725083 )
Consequently, the Release 5 coordinates and predicted cytological breakpoints of the ends of the duplicated medial segment of Dp(1;Y)BSC267  are  X:13656333..13724330 ;15392986 and 12C1-12C6;13C5.