A TI{KozakGAL4} DNA cassette has been inserted into CG10674, replacing the coding sequence (coordinates of deleted sequence are 3L:5135826..5136285 , release 6 genome). This results in a simultaneous knock-out of CG10674 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG10674 (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of asRNA:CR45160. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: AAAACCAGGTCAGATTGCAATGG and AAATTTAAAATAGTTATCTTAGG. The 5' end of the deletion associated with the insertion is 91 bp from the 5' end of the CG4611 gene and may affect its expression.