A TI{CRIMIC.TG4.0} DNA cassette has been inserted into Fer3HCH, in a coding intron, and is predicted to gene trap the single annotated transcript of this gene. The insertion is also within Chpf (Fer3HCH is nested within an intron of Chpf), in a coding intron, and is predicted to gene trap both isoforms of this gene. In addition, the coding exons of Fer3HCH downstream of the inserted gene trap cassette have been deleted (only intronic sequences of Chpf are deleted). The TI{CRIMIC.TG4.0} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target Fer3HCH : one targeted to a coding intron (ATAGTACGTTCAATACACGTAGG) and the other to a non-coding exon in the 3' UTR (TGAAGAATACGTATTATAATTGG).