CRISPR construct designed to result in deletion of the Stim gene when combined with a source of Cas9. A constitutive promoter (snRNA:U6:96Ab) drives expression of two sgRNAs (AATGCGAAAGAATACCATTTGG and GGATGACTGAAGAACCTCTTGG) that target the 5' and 3' end of Stim respectively.
Expression of StimsgRNA.dual.snRNA:U6:96Ab together with Spyo\Cas9Scer\UAS.T:nls-Ude under the control of either Scer\GAL4elav-C155 or Scer\GAL4nSyb.PS or Scer\GAL4ple.PF (to induce tissue-specific gene knock-out) leads to developmental delay and partial lethality as significant proportion of the animals die as third instar larvae. Only females manage to eclose as adults (although the sample number was low) with the Scer\GAL4elav-C155 driver, while when the Scer\GAL4nSyb.PS driver is used both sexes are present in the eclosed adults, only very few adults eclose with the Scer\GAL4ple.PF driver. Scer\GAL4ple.TH-A-driven expression also leads to partial lethality but no significant developmental delay is observed.
Expression of StimsgRNA.dual.snRNA:U6:96Ab together with Spyo\Cas9Scer\UAS.T:nls-Ude under the control of Scer\GAL4ple.PF does not lead to loss of neurons within the driver expression domain in the larval brain and neither Scer\GAL4ple.PF- nor Scer\GAL4ple.TH-A-driven expression results in any defects in mouth hooks development or morphology.
StimsgRNA.dual.snRNA:U6:96Ab is partially rescued by Scer\GAL4elav-C155/StimUAS.cAa/Spyo\Cas9UAS.Tag:NLS(Ude)